Incidental Mutation 'R1502:Dse'
ID169375
Institutional Source Beutler Lab
Gene Symbol Dse
Ensembl Gene ENSMUSG00000039497
Gene Namedermatan sulfate epimerase
SynonymsSart2, DS-epi1, B130024B19Rik
MMRRC Submission 039552-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R1502 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location34151393-34207715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34153218 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 625 (S625R)
Ref Sequence ENSEMBL: ENSMUSP00000040074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048010] [ENSMUST00000217051]
Predicted Effect probably damaging
Transcript: ENSMUST00000048010
AA Change: S625R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040074
Gene: ENSMUSG00000039497
AA Change: S625R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF4962 24 353 5.2e-11 PFAM
low complexity region 558 568 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
transmembrane domain 901 923 N/A INTRINSIC
transmembrane domain 935 952 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216774
Predicted Effect probably benign
Transcript: ENSMUST00000217051
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tumor-rejection antigen. It is localized to the endoplasmic reticulum and functions to convert D-glucuronic acid to L-iduronic acid during the biosynthesis of dermatan sulfate. This antigen possesses tumor epitopes capable of inducing HLA-A24-restricted and tumor-specific cytotoxic T lymphocytes in cancer patients and may be useful for specific immunotherapy. Mutations in this gene cause inmusculocontractural Ehlers-Danlos syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 9, and a paralogous gene exists on chromosome 18. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length with altered skin morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T G 11: 109,974,645 T329P probably damaging Het
Adamts4 C A 1: 171,258,990 P784T probably damaging Het
Adamts6 T C 13: 104,493,637 L1096P probably damaging Het
Ap1b1 A G 11: 5,040,290 S849G probably benign Het
Arap2 T C 5: 62,604,404 S1660G probably benign Het
Atp10b A C 11: 43,230,347 T946P probably damaging Het
Brpf1 A G 6: 113,322,420 D1103G probably damaging Het
Bub1 A G 2: 127,827,419 Y102H probably damaging Het
C87499 T A 4: 88,628,032 I358F probably benign Het
Ccdc182 A G 11: 88,294,367 E91G probably benign Het
Cd200r4 C T 16: 44,833,440 T154M probably damaging Het
Cdh20 A G 1: 104,954,030 T407A probably benign Het
Col6a2 T C 10: 76,614,678 I140V probably benign Het
Csn3 C A 5: 87,930,124 T163K probably damaging Het
Dars2 A T 1: 161,046,805 L438* probably null Het
Dbr1 T C 9: 99,582,387 L289P probably damaging Het
Ddx46 A G 13: 55,663,309 R573G possibly damaging Het
Defb10 T C 8: 21,858,956 I10T possibly damaging Het
Dis3l T C 9: 64,325,787 E136G possibly damaging Het
Dnajb13 T C 7: 100,507,461 Q136R probably benign Het
Dvl3 A G 16: 20,523,459 D94G probably damaging Het
E130311K13Rik A C 3: 63,915,547 Y225* probably null Het
Etnppl A G 3: 130,628,789 I222V probably benign Het
Evc2 T C 5: 37,393,096 L818P probably benign Het
Fbn1 A T 2: 125,363,706 C1083* probably null Het
Flnc G A 6: 29,438,694 V196I probably benign Het
Fscn3 A G 6: 28,435,623 D415G probably benign Het
Gm3448 A G 17: 14,967,614 F133L probably benign Het
Gm4861 A C 3: 137,550,620 V75G probably damaging Het
Gpld1 A T 13: 24,971,416 T345S probably benign Het
Grik4 T C 9: 42,520,873 S943G probably damaging Het
Grik4 C T 9: 42,591,447 R460Q probably benign Het
Ifi207 A C 1: 173,729,306 L629R possibly damaging Het
Ift52 G A 2: 163,029,862 probably null Het
Insl3 A G 8: 71,690,232 D79G probably damaging Het
Kif5a A T 10: 127,245,441 I208N probably damaging Het
Lag3 T C 6: 124,909,243 Y249C probably damaging Het
Lipe T C 7: 25,398,147 N124D possibly damaging Het
Lnpep A G 17: 17,571,644 Y412H probably damaging Het
Lrtm2 A G 6: 119,317,274 Y299H probably benign Het
Lypd4 T C 7: 24,866,828 T24A probably benign Het
Magi1 T A 6: 93,694,170 I805F probably damaging Het
Mfap3 T C 11: 57,528,149 L45P probably benign Het
Nbea G A 3: 56,004,889 P1159L probably benign Het
Ndst4 A T 3: 125,437,758 probably benign Het
Notch1 A T 2: 26,484,323 N229K possibly damaging Het
Nova1 A G 12: 46,720,832 I102T unknown Het
Npepps T C 11: 97,218,575 E725G possibly damaging Het
Olfr1157 T C 2: 87,962,035 N286D probably damaging Het
Olfr211 T C 6: 116,494,281 I224T probably damaging Het
Olfr743 A T 14: 50,533,777 M122L possibly damaging Het
Olfr822 T C 10: 130,074,872 I154T probably damaging Het
Pappa2 A T 1: 158,957,288 W51R probably damaging Het
Pde8a T C 7: 81,292,259 S149P probably damaging Het
Phkb T A 8: 86,059,339 L1052Q possibly damaging Het
Pou5f2 T A 13: 78,025,251 L104Q probably benign Het
Psme2b A T 11: 48,945,749 W124R probably damaging Het
Ptk2b G A 14: 66,163,080 S762L possibly damaging Het
Ptprs T C 17: 56,437,992 N248S probably benign Het
Rgs22 G A 15: 36,080,851 T705I probably damaging Het
Rnf123 T C 9: 108,068,510 probably null Het
Sel1l2 A T 2: 140,389,595 I13N probably damaging Het
Slc39a4 T C 15: 76,616,593 T57A probably benign Het
Smpdl3a T G 10: 57,809,091 V319G probably damaging Het
Syt9 T C 7: 107,436,487 L237P probably damaging Het
Tbc1d16 G T 11: 119,154,004 A536E probably damaging Het
Tcf20 T C 15: 82,855,576 D558G probably damaging Het
Tdpoz2 A T 3: 93,652,146 M173K probably benign Het
Tek A G 4: 94,781,102 I113M probably damaging Het
Tmem50a A T 4: 134,909,669 D50E probably benign Het
Tmem8 A G 17: 26,120,316 T535A possibly damaging Het
Trappc11 A T 8: 47,530,827 V10E possibly damaging Het
Vmn1r172 C T 7: 23,660,256 R189* probably null Het
Vmn2r63 A T 7: 42,928,591 D174E possibly damaging Het
Zc3h10 A T 10: 128,544,282 M402K probably damaging Het
Zfp109 T C 7: 24,228,163 H615R probably damaging Het
Zfp982 A C 4: 147,512,669 H161P probably benign Het
Zhx1 A G 15: 58,054,596 F85L probably damaging Het
Other mutations in Dse
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Dse APN 10 34162805 missense probably damaging 1.00
IGL01828:Dse APN 10 34152776 missense probably damaging 0.97
IGL01835:Dse APN 10 34160217 splice site probably benign
IGL01942:Dse APN 10 34155993 missense probably benign 0.02
IGL02047:Dse APN 10 34162845 nonsense probably null
IGL02208:Dse APN 10 34152437 missense probably benign
IGL02306:Dse APN 10 34160134 missense probably damaging 0.96
IGL02504:Dse APN 10 34152800 missense probably benign
IGL02626:Dse APN 10 34153162 missense probably damaging 0.99
IGL02812:Dse APN 10 34183716 missense probably damaging 1.00
R0018:Dse UTSW 10 34153468 missense probably benign 0.00
R0018:Dse UTSW 10 34153468 missense probably benign 0.00
R0131:Dse UTSW 10 34153664 missense probably damaging 1.00
R1300:Dse UTSW 10 34152415 missense probably benign 0.00
R1619:Dse UTSW 10 34153234 missense probably damaging 1.00
R1736:Dse UTSW 10 34153149 missense probably damaging 1.00
R1857:Dse UTSW 10 34153229 missense probably benign 0.03
R1858:Dse UTSW 10 34153229 missense probably benign 0.03
R1859:Dse UTSW 10 34153229 missense probably benign 0.03
R1868:Dse UTSW 10 34153288 missense possibly damaging 0.86
R1959:Dse UTSW 10 34160206 missense probably damaging 1.00
R2082:Dse UTSW 10 34155940 missense probably damaging 1.00
R2325:Dse UTSW 10 34184047 missense probably benign 0.23
R2883:Dse UTSW 10 34152507 missense probably benign 0.34
R3436:Dse UTSW 10 34152474 missense probably benign
R3818:Dse UTSW 10 34153433 missense probably benign
R4158:Dse UTSW 10 34153334 missense probably damaging 1.00
R4159:Dse UTSW 10 34153334 missense probably damaging 1.00
R4160:Dse UTSW 10 34153334 missense probably damaging 1.00
R4229:Dse UTSW 10 34162744 missense probably damaging 1.00
R4414:Dse UTSW 10 34152636 missense probably benign 0.04
R4667:Dse UTSW 10 34153012 missense probably damaging 1.00
R4669:Dse UTSW 10 34153012 missense probably damaging 1.00
R4777:Dse UTSW 10 34153588 missense possibly damaging 0.56
R5154:Dse UTSW 10 34153661 missense possibly damaging 0.83
R5573:Dse UTSW 10 34152682 missense probably benign 0.02
R5804:Dse UTSW 10 34153379 missense possibly damaging 0.84
R5844:Dse UTSW 10 34153042 missense probably damaging 0.99
R5895:Dse UTSW 10 34152605 missense probably damaging 1.00
R6290:Dse UTSW 10 34152340 missense probably benign 0.00
R6600:Dse UTSW 10 34152541 missense probably benign 0.06
R7088:Dse UTSW 10 34153889 missense probably damaging 1.00
R7254:Dse UTSW 10 34184148 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GATGCTGAAGCTCTGGACATCCAC -3'
(R):5'- AGAAGGCGTAGGAGCATATAACCCC -3'

Sequencing Primer
(F):5'- TCTGGACATCCACAGATGGC -3'
(R):5'- TGAAGCACATTCAACGGAATCTC -3'
Posted On2014-04-13