Incidental Mutation 'R1503:Cd48'
ID169416
Institutional Source Beutler Lab
Gene Symbol Cd48
Ensembl Gene ENSMUSG00000015355
Gene NameCD48 antigen
SynonymsBcm-1, BCM1, BLAST-1, Sgp-60
MMRRC Submission 039553-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.038) question?
Stock #R1503 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171682009-171705258 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 171695847 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 86 (L86H)
Ref Sequence ENSEMBL: ENSMUSP00000064241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015499] [ENSMUST00000068584]
PDB Structure
Structure of NK cell receptor 2B4 (CD244) bound to its ligand CD48 [X-RAY DIFFRACTION]
Structure of NK cell receptor ligand CD48 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000015499
AA Change: L86H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015499
Gene: ENSMUSG00000015355
AA Change: L86H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 28 125 1.96e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000068584
AA Change: L86H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064241
Gene: ENSMUSG00000015355
AA Change: L86H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 28 125 1.96e-6 SMART
IG_like 136 211 1.24e2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CD2 subfamily of immunoglobulin-like receptors which includes SLAM (signaling lymphocyte activation molecules) proteins. The encoded protein is found on the surface of lymphocytes and other immune cells, dendritic cells and endothelial cells, and participates in activation and differentiation pathways in these cells. The encoded protein does not have a transmembrane domain, however, but is held at the cell surface by a GPI anchor via a C-terminal domain which maybe cleaved to yield a soluble form of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in a slight increase in CD4+CD8- thymocytes and impaired T cell proliferation in response to mitogens, anti-CD3 antibodies, and alloantigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Atf7ip G T 6: 136,606,867 V1299L probably damaging Het
Atp12a A T 14: 56,373,424 N342Y probably damaging Het
Atp8b5 G A 4: 43,344,430 G439D probably damaging Het
Bpifb2 G A 2: 153,889,510 D269N possibly damaging Het
Btd T G 14: 31,667,655 C444W probably damaging Het
Cacna1a A G 8: 84,601,946 D1624G probably benign Het
Carmil3 A C 14: 55,498,280 N563T probably damaging Het
Cars T C 7: 143,568,989 R538G probably benign Het
Catsperd A G 17: 56,654,525 K416E possibly damaging Het
Cc2d2a A T 5: 43,695,239 Y386F probably damaging Het
Ccpg1 A G 9: 72,999,478 N66S probably benign Het
Cdan1 A T 2: 120,729,575 H369Q probably damaging Het
Chil4 T C 3: 106,206,034 D189G probably benign Het
Cit T A 5: 115,873,900 Y189N possibly damaging Het
Cntn3 G A 6: 102,464,565 Q7* probably null Het
Csn1s2a A T 5: 87,775,799 I5F possibly damaging Het
Ctnnd1 C T 2: 84,605,179 probably null Het
Dmxl2 A T 9: 54,446,988 Y391* probably null Het
Dnah12 T C 14: 26,773,692 S1426P probably damaging Het
Dnhd1 T G 7: 105,693,660 S1404A possibly damaging Het
Drosha T A 15: 12,848,073 C484S probably benign Het
Dsg4 A T 18: 20,449,679 I125F probably damaging Het
Egfr T A 11: 16,869,301 M277K possibly damaging Het
Eml5 G T 12: 98,831,174 L1059I probably damaging Het
Erbb4 G T 1: 68,346,546 H295N probably benign Het
Etl4 T G 2: 20,743,874 V139G possibly damaging Het
Fam160a1 T A 3: 85,672,477 Y807F possibly damaging Het
Frem3 A T 8: 80,687,018 E1969D probably damaging Het
Gdf3 T A 6: 122,606,337 D357V probably damaging Het
Gimap8 T A 6: 48,647,529 probably null Het
Gml2 C A 15: 74,821,352 S68* probably null Het
Gphn A G 12: 78,504,629 I248V possibly damaging Het
Greb1 A T 12: 16,724,819 Y192* probably null Het
Hmbs A C 9: 44,337,432 L215W probably benign Het
Iglon5 T A 7: 43,479,025 T123S probably benign Het
Ints2 C T 11: 86,226,781 R705H probably damaging Het
Ints8 A T 4: 11,245,842 L212Q probably damaging Het
Itgad A G 7: 128,198,121 Y846C probably benign Het
Kcnj1 A G 9: 32,396,492 T51A probably damaging Het
Kif1bp A G 10: 62,559,408 V485A probably damaging Het
Kif9 A T 9: 110,510,438 K449N possibly damaging Het
Klk11 G A 7: 43,778,909 W241* probably null Het
Krt32 T C 11: 100,084,110 probably null Het
Loxl1 A G 9: 58,293,640 F513S probably damaging Het
Mapk8ip3 A T 17: 24,904,923 S571T probably damaging Het
Mcam C T 9: 44,141,291 R606C probably damaging Het
Mtss1 T C 15: 58,951,672 N282S probably damaging Het
Myh13 T A 11: 67,353,674 D1012E probably benign Het
Myo16 A G 8: 10,502,817 T952A probably benign Het
Neb T C 2: 52,298,620 D874G probably damaging Het
Nek11 A G 9: 105,163,204 Y553H probably damaging Het
Nr2c2 T A 6: 92,105,331 V9D probably benign Het
Nxf1 T A 19: 8,762,436 F51L probably benign Het
Olfr1260 T C 2: 89,978,528 V250A probably damaging Het
Olfr1347 T C 7: 6,488,179 I232V probably damaging Het
Olfr1350 A G 7: 6,570,471 N160S probably damaging Het
Olfr170 A G 16: 19,606,312 S119P probably benign Het
Olfr344 A T 2: 36,568,873 I92F probably damaging Het
Olfr397 T G 11: 73,964,568 probably null Het
Olfr750 A G 14: 51,070,734 S220P probably damaging Het
Pcdhb8 A T 18: 37,356,519 N76Y probably damaging Het
Pdzrn4 T A 15: 92,399,804 F217I probably damaging Het
Ppp1r16a T A 15: 76,694,399 H434Q probably benign Het
Prpf19 T A 19: 10,901,022 F291I possibly damaging Het
R3hdm2 G T 10: 127,471,826 E319* probably null Het
Sel1l3 A G 5: 53,137,929 Y777H probably damaging Het
Serpinb5 G A 1: 106,870,289 A3T possibly damaging Het
Skp2 C A 15: 9,127,911 V88F probably damaging Het
Slc25a16 T C 10: 62,928,376 Y71H probably damaging Het
Slc6a6 T A 6: 91,740,992 I304N probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sox17 C A 1: 4,491,928 G222C probably damaging Het
Trmu T A 15: 85,895,019 V289E possibly damaging Het
Vdac2 A G 14: 21,837,877 E96G probably damaging Het
Wdhd1 A T 14: 47,247,400 D885E probably benign Het
Zfp646 A G 7: 127,880,136 N495S probably damaging Het
Zfp663 T C 2: 165,352,653 T549A probably damaging Het
Zfp935 G A 13: 62,455,137 A83V possibly damaging Het
Other mutations in Cd48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Cd48 APN 1 171695739 missense possibly damaging 0.95
IGL03140:Cd48 APN 1 171695883 missense probably damaging 1.00
R0311:Cd48 UTSW 1 171699580 nonsense probably null
R0490:Cd48 UTSW 1 171704877 makesense probably null
R1365:Cd48 UTSW 1 171699561 missense probably damaging 0.98
R1626:Cd48 UTSW 1 171682119 missense probably benign 0.30
R1628:Cd48 UTSW 1 171704852 missense probably damaging 0.99
R4076:Cd48 UTSW 1 171695883 missense probably damaging 1.00
R4753:Cd48 UTSW 1 171699588 missense probably damaging 0.99
R5488:Cd48 UTSW 1 171695705 missense possibly damaging 0.94
R6365:Cd48 UTSW 1 171682164 missense probably null 0.84
Z1088:Cd48 UTSW 1 171695727 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ATTTAGGCCACTGGATAGCACTGC -3'
(R):5'- GAATGGGCCTTTGTCCCATGACTC -3'

Sequencing Primer
(F):5'- TGGCAGGTCATTCAATACCAG -3'
(R):5'- CTTTGTCCCATGACTCCAAAAC -3'
Posted On2014-04-13