Incidental Mutation 'R1503:Cd48'
ID 169416
Institutional Source Beutler Lab
Gene Symbol Cd48
Ensembl Gene ENSMUSG00000015355
Gene Name CD48 antigen
Synonyms Sgp-60, BCM1, Bcm-1, BLAST-1
MMRRC Submission 039553-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R1503 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 171509577-171532826 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 171523415 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 86 (L86H)
Ref Sequence ENSEMBL: ENSMUSP00000064241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015499] [ENSMUST00000068584]
AlphaFold P18181
PDB Structure Structure of NK cell receptor 2B4 (CD244) bound to its ligand CD48 [X-RAY DIFFRACTION]
Structure of NK cell receptor ligand CD48 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000015499
AA Change: L86H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015499
Gene: ENSMUSG00000015355
AA Change: L86H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 28 125 1.96e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000068584
AA Change: L86H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064241
Gene: ENSMUSG00000015355
AA Change: L86H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 28 125 1.96e-6 SMART
IG_like 136 211 1.24e2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CD2 subfamily of immunoglobulin-like receptors which includes SLAM (signaling lymphocyte activation molecules) proteins. The encoded protein is found on the surface of lymphocytes and other immune cells, dendritic cells and endothelial cells, and participates in activation and differentiation pathways in these cells. The encoded protein does not have a transmembrane domain, however, but is held at the cell surface by a GPI anchor via a C-terminal domain which maybe cleaved to yield a soluble form of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in a slight increase in CD4+CD8- thymocytes and impaired T cell proliferation in response to mitogens, anti-CD3 antibodies, and alloantigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef6 T C X: 56,383,922 (GRCm39) M5V probably benign Het
Atf7ip G T 6: 136,583,865 (GRCm39) V1299L probably damaging Het
Atp12a A T 14: 56,610,881 (GRCm39) N342Y probably damaging Het
Atp8b5 G A 4: 43,344,430 (GRCm39) G439D probably damaging Het
Bpifb2 G A 2: 153,731,430 (GRCm39) D269N possibly damaging Het
Btd T G 14: 31,389,612 (GRCm39) C444W probably damaging Het
Cacna1a A G 8: 85,328,575 (GRCm39) D1624G probably benign Het
Carmil3 A C 14: 55,735,737 (GRCm39) N563T probably damaging Het
Cars1 T C 7: 143,122,726 (GRCm39) R538G probably benign Het
Catsperd A G 17: 56,961,525 (GRCm39) K416E possibly damaging Het
Cc2d2a A T 5: 43,852,581 (GRCm39) Y386F probably damaging Het
Ccpg1 A G 9: 72,906,760 (GRCm39) N66S probably benign Het
Cdan1 A T 2: 120,560,056 (GRCm39) H369Q probably damaging Het
Chil4 T C 3: 106,113,350 (GRCm39) D189G probably benign Het
Cit T A 5: 116,011,959 (GRCm39) Y189N possibly damaging Het
Cntn3 G A 6: 102,441,526 (GRCm39) Q7* probably null Het
Csn1s2a A T 5: 87,923,658 (GRCm39) I5F possibly damaging Het
Ctnnd1 C T 2: 84,435,523 (GRCm39) probably null Het
Dmxl2 A T 9: 54,354,272 (GRCm39) Y391* probably null Het
Dnah12 T C 14: 26,495,649 (GRCm39) S1426P probably damaging Het
Dnhd1 T G 7: 105,342,867 (GRCm39) S1404A possibly damaging Het
Drosha T A 15: 12,848,159 (GRCm39) C484S probably benign Het
Dsg4 A T 18: 20,582,736 (GRCm39) I125F probably damaging Het
Egfr T A 11: 16,819,301 (GRCm39) M277K possibly damaging Het
Eml5 G T 12: 98,797,433 (GRCm39) L1059I probably damaging Het
Erbb4 G T 1: 68,385,705 (GRCm39) H295N probably benign Het
Etl4 T G 2: 20,748,685 (GRCm39) V139G possibly damaging Het
Fhip1a T A 3: 85,579,784 (GRCm39) Y807F possibly damaging Het
Frem3 A T 8: 81,413,647 (GRCm39) E1969D probably damaging Het
Gdf3 T A 6: 122,583,296 (GRCm39) D357V probably damaging Het
Gimap8 T A 6: 48,624,463 (GRCm39) probably null Het
Gml2 C A 15: 74,693,201 (GRCm39) S68* probably null Het
Gphn A G 12: 78,551,403 (GRCm39) I248V possibly damaging Het
Greb1 A T 12: 16,774,820 (GRCm39) Y192* probably null Het
Hmbs A C 9: 44,248,729 (GRCm39) L215W probably benign Het
Iglon5 T A 7: 43,128,449 (GRCm39) T123S probably benign Het
Ints2 C T 11: 86,117,607 (GRCm39) R705H probably damaging Het
Ints8 A T 4: 11,245,842 (GRCm39) L212Q probably damaging Het
Itgad A G 7: 127,797,293 (GRCm39) Y846C probably benign Het
Kcnj1 A G 9: 32,307,788 (GRCm39) T51A probably damaging Het
Kif9 A T 9: 110,339,506 (GRCm39) K449N possibly damaging Het
Kifbp A G 10: 62,395,187 (GRCm39) V485A probably damaging Het
Klk1b11 G A 7: 43,428,333 (GRCm39) W241* probably null Het
Krt32 T C 11: 99,974,936 (GRCm39) probably null Het
Loxl1 A G 9: 58,200,923 (GRCm39) F513S probably damaging Het
Mapk8ip3 A T 17: 25,123,897 (GRCm39) S571T probably damaging Het
Mcam C T 9: 44,052,588 (GRCm39) R606C probably damaging Het
Mtss1 T C 15: 58,823,521 (GRCm39) N282S probably damaging Het
Myh13 T A 11: 67,244,500 (GRCm39) D1012E probably benign Het
Myo16 A G 8: 10,552,817 (GRCm39) T952A probably benign Het
Neb T C 2: 52,188,632 (GRCm39) D874G probably damaging Het
Nek11 A G 9: 105,040,403 (GRCm39) Y553H probably damaging Het
Nr2c2 T A 6: 92,082,312 (GRCm39) V9D probably benign Het
Nxf1 T A 19: 8,739,800 (GRCm39) F51L probably benign Het
Or1e1f T G 11: 73,855,394 (GRCm39) probably null Het
Or1j15 A T 2: 36,458,885 (GRCm39) I92F probably damaging Het
Or2aj5 A G 16: 19,425,062 (GRCm39) S119P probably benign Het
Or4c35 T C 2: 89,808,872 (GRCm39) V250A probably damaging Het
Or5bw2 A G 7: 6,573,470 (GRCm39) N160S probably damaging Het
Or6s1 A G 14: 51,308,191 (GRCm39) S220P probably damaging Het
Or6z6 T C 7: 6,491,178 (GRCm39) I232V probably damaging Het
Pcdhb8 A T 18: 37,489,572 (GRCm39) N76Y probably damaging Het
Pdzrn4 T A 15: 92,297,685 (GRCm39) F217I probably damaging Het
Ppp1r16a T A 15: 76,578,599 (GRCm39) H434Q probably benign Het
Prpf19 T A 19: 10,878,386 (GRCm39) F291I possibly damaging Het
R3hdm2 G T 10: 127,307,695 (GRCm39) E319* probably null Het
Sel1l3 A G 5: 53,295,271 (GRCm39) Y777H probably damaging Het
Serpinb5 G A 1: 106,798,019 (GRCm39) A3T possibly damaging Het
Skp2 C A 15: 9,127,998 (GRCm39) V88F probably damaging Het
Slc25a16 T C 10: 62,764,155 (GRCm39) Y71H probably damaging Het
Slc6a6 T A 6: 91,717,973 (GRCm39) I304N probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Sox17 C A 1: 4,562,151 (GRCm39) G222C probably damaging Het
Trmu T A 15: 85,779,220 (GRCm39) V289E possibly damaging Het
Vdac2 A G 14: 21,887,945 (GRCm39) E96G probably damaging Het
Wdhd1 A T 14: 47,484,857 (GRCm39) D885E probably benign Het
Zfp646 A G 7: 127,479,308 (GRCm39) N495S probably damaging Het
Zfp663 T C 2: 165,194,573 (GRCm39) T549A probably damaging Het
Zfp935 G A 13: 62,602,951 (GRCm39) A83V possibly damaging Het
Other mutations in Cd48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Cd48 APN 1 171,523,307 (GRCm39) missense possibly damaging 0.95
IGL03140:Cd48 APN 1 171,523,451 (GRCm39) missense probably damaging 1.00
R0311:Cd48 UTSW 1 171,527,148 (GRCm39) nonsense probably null
R0490:Cd48 UTSW 1 171,532,445 (GRCm39) makesense probably null
R1365:Cd48 UTSW 1 171,527,129 (GRCm39) missense probably damaging 0.98
R1626:Cd48 UTSW 1 171,509,687 (GRCm39) missense probably benign 0.30
R1628:Cd48 UTSW 1 171,532,420 (GRCm39) missense probably damaging 0.99
R4076:Cd48 UTSW 1 171,523,451 (GRCm39) missense probably damaging 1.00
R4753:Cd48 UTSW 1 171,527,156 (GRCm39) missense probably damaging 0.99
R5488:Cd48 UTSW 1 171,523,273 (GRCm39) missense possibly damaging 0.94
R6365:Cd48 UTSW 1 171,509,732 (GRCm39) missense probably null 0.84
R7216:Cd48 UTSW 1 171,523,390 (GRCm39) missense probably damaging 1.00
R7400:Cd48 UTSW 1 171,523,493 (GRCm39) missense probably benign 0.00
R7702:Cd48 UTSW 1 171,523,348 (GRCm39) missense probably damaging 0.99
R8041:Cd48 UTSW 1 171,526,958 (GRCm39) missense probably damaging 0.99
R9424:Cd48 UTSW 1 171,532,432 (GRCm39) missense possibly damaging 0.92
Z1088:Cd48 UTSW 1 171,523,295 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ATTTAGGCCACTGGATAGCACTGC -3'
(R):5'- GAATGGGCCTTTGTCCCATGACTC -3'

Sequencing Primer
(F):5'- TGGCAGGTCATTCAATACCAG -3'
(R):5'- CTTTGTCCCATGACTCCAAAAC -3'
Posted On 2014-04-13