Incidental Mutation 'R1503:Ints8'
ID169431
Institutional Source Beutler Lab
Gene Symbol Ints8
Ensembl Gene ENSMUSG00000040738
Gene Nameintegrator complex subunit 8
Synonyms2810013E07Rik, D130008D20Rik
MMRRC Submission 039553-MU
Accession Numbers

Ncbi RefSeq: NM_001159595.1, NM_178112.5; MGI:1919906

Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R1503 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location11199158-11254258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11245842 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 212 (L212Q)
Ref Sequence ENSEMBL: ENSMUSP00000103954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044616] [ENSMUST00000108318] [ENSMUST00000108319]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044616
AA Change: L212Q

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738
AA Change: L212Q

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108318
AA Change: L212Q

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103954
Gene: ENSMUSG00000040738
AA Change: L212Q

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
SCOP:d1a17__ 826 961 9e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108319
AA Change: L212Q

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103955
Gene: ENSMUSG00000040738
AA Change: L212Q

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex which is involved in the cleavage of small nuclear RNAs U1 and U2 within the nucleus. The encoded protein associates with RNA polymerase II and is recruited to the U1 and U2 small nuclear RNA genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI

All alleles(14) : Targeted(1) Gene trapped(13)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Atf7ip G T 6: 136,606,867 V1299L probably damaging Het
Atp12a A T 14: 56,373,424 N342Y probably damaging Het
Atp8b5 G A 4: 43,344,430 G439D probably damaging Het
Bpifb2 G A 2: 153,889,510 D269N possibly damaging Het
Btd T G 14: 31,667,655 C444W probably damaging Het
Cacna1a A G 8: 84,601,946 D1624G probably benign Het
Carmil3 A C 14: 55,498,280 N563T probably damaging Het
Cars T C 7: 143,568,989 R538G probably benign Het
Catsperd A G 17: 56,654,525 K416E possibly damaging Het
Cc2d2a A T 5: 43,695,239 Y386F probably damaging Het
Ccpg1 A G 9: 72,999,478 N66S probably benign Het
Cd48 T A 1: 171,695,847 L86H probably damaging Het
Cdan1 A T 2: 120,729,575 H369Q probably damaging Het
Chil4 T C 3: 106,206,034 D189G probably benign Het
Cit T A 5: 115,873,900 Y189N possibly damaging Het
Cntn3 G A 6: 102,464,565 Q7* probably null Het
Csn1s2a A T 5: 87,775,799 I5F possibly damaging Het
Ctnnd1 C T 2: 84,605,179 probably null Het
Dmxl2 A T 9: 54,446,988 Y391* probably null Het
Dnah12 T C 14: 26,773,692 S1426P probably damaging Het
Dnhd1 T G 7: 105,693,660 S1404A possibly damaging Het
Drosha T A 15: 12,848,073 C484S probably benign Het
Dsg4 A T 18: 20,449,679 I125F probably damaging Het
Egfr T A 11: 16,869,301 M277K possibly damaging Het
Eml5 G T 12: 98,831,174 L1059I probably damaging Het
Erbb4 G T 1: 68,346,546 H295N probably benign Het
Etl4 T G 2: 20,743,874 V139G possibly damaging Het
Fam160a1 T A 3: 85,672,477 Y807F possibly damaging Het
Frem3 A T 8: 80,687,018 E1969D probably damaging Het
Gdf3 T A 6: 122,606,337 D357V probably damaging Het
Gimap8 T A 6: 48,647,529 probably null Het
Gml2 C A 15: 74,821,352 S68* probably null Het
Gphn A G 12: 78,504,629 I248V possibly damaging Het
Greb1 A T 12: 16,724,819 Y192* probably null Het
Hmbs A C 9: 44,337,432 L215W probably benign Het
Iglon5 T A 7: 43,479,025 T123S probably benign Het
Ints2 C T 11: 86,226,781 R705H probably damaging Het
Itgad A G 7: 128,198,121 Y846C probably benign Het
Kcnj1 A G 9: 32,396,492 T51A probably damaging Het
Kif1bp A G 10: 62,559,408 V485A probably damaging Het
Kif9 A T 9: 110,510,438 K449N possibly damaging Het
Klk11 G A 7: 43,778,909 W241* probably null Het
Krt32 T C 11: 100,084,110 probably null Het
Loxl1 A G 9: 58,293,640 F513S probably damaging Het
Mapk8ip3 A T 17: 24,904,923 S571T probably damaging Het
Mcam C T 9: 44,141,291 R606C probably damaging Het
Mtss1 T C 15: 58,951,672 N282S probably damaging Het
Myh13 T A 11: 67,353,674 D1012E probably benign Het
Myo16 A G 8: 10,502,817 T952A probably benign Het
Neb T C 2: 52,298,620 D874G probably damaging Het
Nek11 A G 9: 105,163,204 Y553H probably damaging Het
Nr2c2 T A 6: 92,105,331 V9D probably benign Het
Nxf1 T A 19: 8,762,436 F51L probably benign Het
Olfr1260 T C 2: 89,978,528 V250A probably damaging Het
Olfr1347 T C 7: 6,488,179 I232V probably damaging Het
Olfr1350 A G 7: 6,570,471 N160S probably damaging Het
Olfr170 A G 16: 19,606,312 S119P probably benign Het
Olfr344 A T 2: 36,568,873 I92F probably damaging Het
Olfr397 T G 11: 73,964,568 probably null Het
Olfr750 A G 14: 51,070,734 S220P probably damaging Het
Pcdhb8 A T 18: 37,356,519 N76Y probably damaging Het
Pdzrn4 T A 15: 92,399,804 F217I probably damaging Het
Ppp1r16a T A 15: 76,694,399 H434Q probably benign Het
Prpf19 T A 19: 10,901,022 F291I possibly damaging Het
R3hdm2 G T 10: 127,471,826 E319* probably null Het
Sel1l3 A G 5: 53,137,929 Y777H probably damaging Het
Serpinb5 G A 1: 106,870,289 A3T possibly damaging Het
Skp2 C A 15: 9,127,911 V88F probably damaging Het
Slc25a16 T C 10: 62,928,376 Y71H probably damaging Het
Slc6a6 T A 6: 91,740,992 I304N probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sox17 C A 1: 4,491,928 G222C probably damaging Het
Trmu T A 15: 85,895,019 V289E possibly damaging Het
Vdac2 A G 14: 21,837,877 E96G probably damaging Het
Wdhd1 A T 14: 47,247,400 D885E probably benign Het
Zfp646 A G 7: 127,880,136 N495S probably damaging Het
Zfp663 T C 2: 165,352,653 T549A probably damaging Het
Zfp935 G A 13: 62,455,137 A83V possibly damaging Het
Other mutations in Ints8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Ints8 APN 4 11218679 splice site probably benign
IGL01925:Ints8 APN 4 11235617 splice site probably benign
IGL02195:Ints8 APN 4 11221222 missense probably damaging 1.00
IGL02215:Ints8 APN 4 11209244 missense probably damaging 1.00
IGL02429:Ints8 APN 4 11231720 missense probably damaging 1.00
IGL02484:Ints8 APN 4 11208834 nonsense probably null
IGL02558:Ints8 APN 4 11218771 missense probably damaging 1.00
IGL02725:Ints8 APN 4 11239406 missense probably benign 0.01
IGL02742:Ints8 APN 4 11241627 missense possibly damaging 0.75
IGL02831:Ints8 APN 4 11245896 missense possibly damaging 0.51
IGL03140:Ints8 APN 4 11235565 missense probably damaging 1.00
IGL03171:Ints8 APN 4 11231702 missense probably benign 0.01
IGL03335:Ints8 APN 4 11216460 missense probably damaging 1.00
P0026:Ints8 UTSW 4 11225788 nonsense probably null
R0054:Ints8 UTSW 4 11204595 utr 3 prime probably benign
R0063:Ints8 UTSW 4 11252857 missense probably damaging 1.00
R0063:Ints8 UTSW 4 11252857 missense probably damaging 1.00
R0184:Ints8 UTSW 4 11218637 missense probably benign 0.03
R0299:Ints8 UTSW 4 11246097 missense probably benign 0.04
R0499:Ints8 UTSW 4 11246097 missense probably benign 0.04
R0540:Ints8 UTSW 4 11252926 missense possibly damaging 0.94
R0657:Ints8 UTSW 4 11246097 missense probably benign 0.04
R1232:Ints8 UTSW 4 11234587 missense possibly damaging 0.81
R1296:Ints8 UTSW 4 11221204 missense possibly damaging 0.95
R1390:Ints8 UTSW 4 11239461 missense probably benign 0.22
R1587:Ints8 UTSW 4 11245722 critical splice donor site probably null
R1701:Ints8 UTSW 4 11231656 missense probably damaging 1.00
R1721:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1757:Ints8 UTSW 4 11254109 start codon destroyed probably null 0.99
R1777:Ints8 UTSW 4 11225600 critical splice donor site probably null
R1867:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1868:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1952:Ints8 UTSW 4 11221150 missense probably benign 0.21
R2084:Ints8 UTSW 4 11230377 missense probably benign 0.31
R2108:Ints8 UTSW 4 11235552 missense probably damaging 0.99
R2202:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2203:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2205:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2439:Ints8 UTSW 4 11225725 missense probably benign 0.29
R2504:Ints8 UTSW 4 11241642 missense probably benign 0.03
R3824:Ints8 UTSW 4 11225621 nonsense probably null
R4664:Ints8 UTSW 4 11227152 missense probably benign 0.04
R4703:Ints8 UTSW 4 11223785 missense possibly damaging 0.92
R4895:Ints8 UTSW 4 11230367 nonsense probably null
R5206:Ints8 UTSW 4 11216477 missense possibly damaging 0.65
R5262:Ints8 UTSW 4 11211916 missense probably damaging 1.00
R5505:Ints8 UTSW 4 11221143 missense probably benign 0.18
R5513:Ints8 UTSW 4 11248303 missense possibly damaging 0.79
R5750:Ints8 UTSW 4 11241654 missense possibly damaging 0.81
R5892:Ints8 UTSW 4 11223813 missense probably damaging 1.00
R6007:Ints8 UTSW 4 11208845 missense possibly damaging 0.70
R6229:Ints8 UTSW 4 11252891 missense probably damaging 1.00
R6466:Ints8 UTSW 4 11252878 missense probably damaging 0.99
R6709:Ints8 UTSW 4 11221117 missense possibly damaging 0.65
R6986:Ints8 UTSW 4 11204474 missense probably damaging 1.00
R6998:Ints8 UTSW 4 11204537 missense possibly damaging 0.80
R7074:Ints8 UTSW 4 11204574 missense possibly damaging 0.82
R7221:Ints8 UTSW 4 11225613 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCTACGTGTTGATAATCCCAGCAG -3'
(R):5'- TGCAAAGCACTTGAGAAGGCCC -3'

Sequencing Primer
(F):5'- aaaataaagacagacagacagacag -3'
(R):5'- CTTCATGCTGAAGAACGAGAGTC -3'
Posted On2014-04-13