Incidental Mutation 'R1503:Cntn3'
ID169440
Institutional Source Beutler Lab
Gene Symbol Cntn3
Ensembl Gene ENSMUSG00000030075
Gene Namecontactin 3
SynonymsPang
MMRRC Submission 039553-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R1503 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location102162655-102573101 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 102464565 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 7 (Q7*)
Ref Sequence ENSEMBL: ENSMUSP00000145176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032159] [ENSMUST00000203619]
Predicted Effect probably null
Transcript: ENSMUST00000032159
AA Change: Q7*
SMART Domains Protein: ENSMUSP00000032159
Gene: ENSMUSG00000030075
AA Change: Q7*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 1.85e-7 SMART
IG 129 217 1.82e-6 SMART
IGc2 240 304 6.8e-15 SMART
IGc2 330 393 1.74e-12 SMART
IGc2 422 486 1.53e-8 SMART
IG 506 595 5.2e-11 SMART
FN3 598 684 3.4e-13 SMART
FN3 701 787 5.36e-2 SMART
FN3 803 888 4.63e-6 SMART
FN3 903 983 1.07e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203619
AA Change: Q7*
SMART Domains Protein: ENSMUSP00000145176
Gene: ENSMUSG00000030075
AA Change: Q7*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 1.85e-7 SMART
IG 129 217 1.82e-6 SMART
IGc2 240 304 6.8e-15 SMART
IGc2 330 393 1.74e-12 SMART
IGc2 422 486 1.53e-8 SMART
IG 506 595 5.2e-11 SMART
FN3 598 684 3.4e-13 SMART
FN3 701 787 5.36e-2 SMART
FN3 803 888 4.63e-6 SMART
FN3 903 983 1.07e-1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Atf7ip G T 6: 136,606,867 V1299L probably damaging Het
Atp12a A T 14: 56,373,424 N342Y probably damaging Het
Atp8b5 G A 4: 43,344,430 G439D probably damaging Het
Bpifb2 G A 2: 153,889,510 D269N possibly damaging Het
Btd T G 14: 31,667,655 C444W probably damaging Het
Cacna1a A G 8: 84,601,946 D1624G probably benign Het
Carmil3 A C 14: 55,498,280 N563T probably damaging Het
Cars T C 7: 143,568,989 R538G probably benign Het
Catsperd A G 17: 56,654,525 K416E possibly damaging Het
Cc2d2a A T 5: 43,695,239 Y386F probably damaging Het
Ccpg1 A G 9: 72,999,478 N66S probably benign Het
Cd48 T A 1: 171,695,847 L86H probably damaging Het
Cdan1 A T 2: 120,729,575 H369Q probably damaging Het
Chil4 T C 3: 106,206,034 D189G probably benign Het
Cit T A 5: 115,873,900 Y189N possibly damaging Het
Csn1s2a A T 5: 87,775,799 I5F possibly damaging Het
Ctnnd1 C T 2: 84,605,179 probably null Het
Dmxl2 A T 9: 54,446,988 Y391* probably null Het
Dnah12 T C 14: 26,773,692 S1426P probably damaging Het
Dnhd1 T G 7: 105,693,660 S1404A possibly damaging Het
Drosha T A 15: 12,848,073 C484S probably benign Het
Dsg4 A T 18: 20,449,679 I125F probably damaging Het
Egfr T A 11: 16,869,301 M277K possibly damaging Het
Eml5 G T 12: 98,831,174 L1059I probably damaging Het
Erbb4 G T 1: 68,346,546 H295N probably benign Het
Etl4 T G 2: 20,743,874 V139G possibly damaging Het
Fam160a1 T A 3: 85,672,477 Y807F possibly damaging Het
Frem3 A T 8: 80,687,018 E1969D probably damaging Het
Gdf3 T A 6: 122,606,337 D357V probably damaging Het
Gimap8 T A 6: 48,647,529 probably null Het
Gml2 C A 15: 74,821,352 S68* probably null Het
Gphn A G 12: 78,504,629 I248V possibly damaging Het
Greb1 A T 12: 16,724,819 Y192* probably null Het
Hmbs A C 9: 44,337,432 L215W probably benign Het
Iglon5 T A 7: 43,479,025 T123S probably benign Het
Ints2 C T 11: 86,226,781 R705H probably damaging Het
Ints8 A T 4: 11,245,842 L212Q probably damaging Het
Itgad A G 7: 128,198,121 Y846C probably benign Het
Kcnj1 A G 9: 32,396,492 T51A probably damaging Het
Kif1bp A G 10: 62,559,408 V485A probably damaging Het
Kif9 A T 9: 110,510,438 K449N possibly damaging Het
Klk11 G A 7: 43,778,909 W241* probably null Het
Krt32 T C 11: 100,084,110 probably null Het
Loxl1 A G 9: 58,293,640 F513S probably damaging Het
Mapk8ip3 A T 17: 24,904,923 S571T probably damaging Het
Mcam C T 9: 44,141,291 R606C probably damaging Het
Mtss1 T C 15: 58,951,672 N282S probably damaging Het
Myh13 T A 11: 67,353,674 D1012E probably benign Het
Myo16 A G 8: 10,502,817 T952A probably benign Het
Neb T C 2: 52,298,620 D874G probably damaging Het
Nek11 A G 9: 105,163,204 Y553H probably damaging Het
Nr2c2 T A 6: 92,105,331 V9D probably benign Het
Nxf1 T A 19: 8,762,436 F51L probably benign Het
Olfr1260 T C 2: 89,978,528 V250A probably damaging Het
Olfr1347 T C 7: 6,488,179 I232V probably damaging Het
Olfr1350 A G 7: 6,570,471 N160S probably damaging Het
Olfr170 A G 16: 19,606,312 S119P probably benign Het
Olfr344 A T 2: 36,568,873 I92F probably damaging Het
Olfr397 T G 11: 73,964,568 probably null Het
Olfr750 A G 14: 51,070,734 S220P probably damaging Het
Pcdhb8 A T 18: 37,356,519 N76Y probably damaging Het
Pdzrn4 T A 15: 92,399,804 F217I probably damaging Het
Ppp1r16a T A 15: 76,694,399 H434Q probably benign Het
Prpf19 T A 19: 10,901,022 F291I possibly damaging Het
R3hdm2 G T 10: 127,471,826 E319* probably null Het
Sel1l3 A G 5: 53,137,929 Y777H probably damaging Het
Serpinb5 G A 1: 106,870,289 A3T possibly damaging Het
Skp2 C A 15: 9,127,911 V88F probably damaging Het
Slc25a16 T C 10: 62,928,376 Y71H probably damaging Het
Slc6a6 T A 6: 91,740,992 I304N probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sox17 C A 1: 4,491,928 G222C probably damaging Het
Trmu T A 15: 85,895,019 V289E possibly damaging Het
Vdac2 A G 14: 21,837,877 E96G probably damaging Het
Wdhd1 A T 14: 47,247,400 D885E probably benign Het
Zfp646 A G 7: 127,880,136 N495S probably damaging Het
Zfp663 T C 2: 165,352,653 T549A probably damaging Het
Zfp935 G A 13: 62,455,137 A83V possibly damaging Het
Other mutations in Cntn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Cntn3 APN 6 102420262 nonsense probably null
IGL00706:Cntn3 APN 6 102203949 missense probably benign 0.11
IGL01071:Cntn3 APN 6 102420251 critical splice donor site probably null
IGL01769:Cntn3 APN 6 102208184 missense probably damaging 1.00
IGL01995:Cntn3 APN 6 102203885 missense probably damaging 1.00
IGL02058:Cntn3 APN 6 102199360 splice site probably benign
IGL02736:Cntn3 APN 6 102203939 missense probably damaging 1.00
IGL02955:Cntn3 APN 6 102278301 missense probably damaging 1.00
IGL02971:Cntn3 APN 6 102168933 missense probably damaging 1.00
IGL03208:Cntn3 APN 6 102187099 missense probably damaging 0.99
P0037:Cntn3 UTSW 6 102209274 missense probably damaging 1.00
R0314:Cntn3 UTSW 6 102420381 missense probably damaging 1.00
R0388:Cntn3 UTSW 6 102277316 missense probably damaging 0.96
R0483:Cntn3 UTSW 6 102203966 missense probably damaging 1.00
R0539:Cntn3 UTSW 6 102277217 critical splice donor site probably null
R0543:Cntn3 UTSW 6 102269090 splice site probably benign
R0629:Cntn3 UTSW 6 102203976 missense probably damaging 1.00
R0691:Cntn3 UTSW 6 102168947 missense possibly damaging 0.48
R0693:Cntn3 UTSW 6 102168947 missense possibly damaging 0.48
R0781:Cntn3 UTSW 6 102245158 missense probably benign 0.22
R1110:Cntn3 UTSW 6 102245158 missense probably benign 0.22
R1144:Cntn3 UTSW 6 102242126 missense possibly damaging 0.65
R1640:Cntn3 UTSW 6 102242013 missense possibly damaging 0.82
R1681:Cntn3 UTSW 6 102170668 missense probably damaging 1.00
R1770:Cntn3 UTSW 6 102269205 missense possibly damaging 0.49
R1782:Cntn3 UTSW 6 102273811 missense probably damaging 0.97
R1861:Cntn3 UTSW 6 102245071 missense probably benign 0.11
R1930:Cntn3 UTSW 6 102242053 nonsense probably null
R2026:Cntn3 UTSW 6 102420427 missense probably damaging 1.00
R2152:Cntn3 UTSW 6 102206537 missense probably damaging 1.00
R2313:Cntn3 UTSW 6 102203928 missense probably benign
R2351:Cntn3 UTSW 6 102337383 missense possibly damaging 0.55
R3611:Cntn3 UTSW 6 102208077 missense possibly damaging 0.77
R4349:Cntn3 UTSW 6 102199351 missense probably damaging 1.00
R4421:Cntn3 UTSW 6 102464547 missense probably damaging 0.97
R4513:Cntn3 UTSW 6 102168982 missense probably benign 0.37
R4678:Cntn3 UTSW 6 102204020 missense probably damaging 1.00
R4702:Cntn3 UTSW 6 102165331 missense probably benign 0.37
R4720:Cntn3 UTSW 6 102242022 missense possibly damaging 0.65
R4879:Cntn3 UTSW 6 102267428 missense possibly damaging 0.47
R4951:Cntn3 UTSW 6 102169025 missense possibly damaging 0.90
R5410:Cntn3 UTSW 6 102278353 missense probably benign 0.01
R5502:Cntn3 UTSW 6 102265334 missense possibly damaging 0.58
R5852:Cntn3 UTSW 6 102420416 missense probably damaging 1.00
R5903:Cntn3 UTSW 6 102242133 missense probably benign 0.00
R6193:Cntn3 UTSW 6 102208131 missense probably benign 0.31
R6258:Cntn3 UTSW 6 102277217 critical splice donor site probably null
R6260:Cntn3 UTSW 6 102277217 critical splice donor site probably null
R6350:Cntn3 UTSW 6 102170618 missense probably damaging 1.00
R6490:Cntn3 UTSW 6 102278340 missense probably damaging 0.99
Z1088:Cntn3 UTSW 6 102420294 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TGTAACCCTTCTCTTGGACTACTAAGCA -3'
(R):5'- CATCTTCCCATCAGTTGCACATACTGTT -3'

Sequencing Primer
(F):5'- agtatgggagaggaaggcag -3'
(R):5'- CATCAGAGACCAGACAAGAGTC -3'
Posted On2014-04-13