Incidental Mutation 'R1536:Prom1'
ID169520
Institutional Source Beutler Lab
Gene Symbol Prom1
Ensembl Gene ENSMUSG00000029086
Gene Nameprominin 1
Synonyms4932416E19Rik, Prom, AC133, CD133, Prom-1
MMRRC Submission 039575-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock #R1536 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location43993620-44102032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44018353 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 508 (Y508F)
Ref Sequence ENSEMBL: ENSMUSP00000030973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030973] [ENSMUST00000074113] [ENSMUST00000087441] [ENSMUST00000087442] [ENSMUST00000165909] [ENSMUST00000171543] [ENSMUST00000177946] [ENSMUST00000179059] [ENSMUST00000197706] [ENSMUST00000197750]
Predicted Effect probably benign
Transcript: ENSMUST00000030973
AA Change: Y508F

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030973
Gene: ENSMUSG00000029086
AA Change: Y508F

DomainStartEndE-ValueType
Pfam:Prominin 11 326 1.5e-113 PFAM
Pfam:Prominin 322 798 4.6e-188 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074113
AA Change: Y542F

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000073751
Gene: ENSMUSG00000029086
AA Change: Y542F

DomainStartEndE-ValueType
low complexity region 8 13 N/A INTRINSIC
Pfam:Prominin 18 822 2e-294 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087441
AA Change: Y533F

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000084707
Gene: ENSMUSG00000029086
AA Change: Y533F

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087442
AA Change: Y533F

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000084709
Gene: ENSMUSG00000029086
AA Change: Y533F

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165909
AA Change: Y533F

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129909
Gene: ENSMUSG00000029086
AA Change: Y533F

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171543
AA Change: Y542F

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000128978
Gene: ENSMUSG00000029086
AA Change: Y542F

DomainStartEndE-ValueType
Pfam:Prominin 11 838 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177946
AA Change: Y533F

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000136483
Gene: ENSMUSG00000029086
AA Change: Y533F

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179059
AA Change: Y542F

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137557
Gene: ENSMUSG00000029086
AA Change: Y542F

DomainStartEndE-ValueType
Pfam:Prominin 11 838 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196853
Predicted Effect probably benign
Transcript: ENSMUST00000197706
AA Change: Y503F

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142632
Gene: ENSMUSG00000029086
AA Change: Y503F

DomainStartEndE-ValueType
Pfam:Prominin 11 321 6.6e-110 PFAM
Pfam:Prominin 317 793 6.8e-188 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197750
AA Change: Y533F

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142375
Gene: ENSMUSG00000029086
AA Change: Y533F

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Meta Mutation Damage Score 0.008 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pentaspan transmembrane glycoprotein. The protein localizes to membrane protrusions and is often expressed on adult stem cells, where it is thought to function in maintaining stem cell properties by suppressing differentiation. Mutations in this gene have been shown to result in retinitis pigmentosa and Stargardt disease. Expression of this gene is also associated with several types of cancer. This gene is expressed from at least five alternative promoters that are expressed in a tissue-dependent manner. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retina morphology, vasculature, and electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,970,665 I3F probably benign Het
4930590J08Rik A G 6: 91,917,035 N211S probably benign Het
A2ml1 A T 6: 128,547,233 Y1145* probably null Het
Abca7 A G 10: 80,014,230 D1972G probably benign Het
Adamts19 A T 18: 59,052,615 D1187V probably damaging Het
Adcy6 G C 15: 98,600,007 I421M probably damaging Het
Afap1 C A 5: 35,974,491 H387Q probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Auts2 C T 5: 131,487,463 probably benign Het
Cbll1 T C 12: 31,487,856 D300G probably damaging Het
Cd200r4 A T 16: 44,833,049 T61S possibly damaging Het
Chmp4c G T 3: 10,389,684 V207L probably benign Het
Cntn5 T C 9: 9,976,316 T413A possibly damaging Het
Cox7a2 T A 9: 79,758,581 probably null Het
Cwc27 A G 13: 104,797,306 L236P probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Dst T A 1: 34,260,372 probably benign Het
Ear1 T A 14: 43,819,126 H95L probably damaging Het
Enpp1 T A 10: 24,641,834 H898L probably benign Het
Entpd5 G A 12: 84,382,295 R321* probably null Het
Ercc6l2 C A 13: 63,824,871 N177K possibly damaging Het
Ergic1 T C 17: 26,641,706 probably null Het
Erich6 A T 3: 58,626,598 I336N probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galnt3 A T 2: 66,084,206 D622E probably damaging Het
Gjd4 T A 18: 9,280,569 T170S probably damaging Het
Gm5611 G A 9: 17,030,607 noncoding transcript Het
Gpc5 T A 14: 115,399,250 N448K probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Man2b2 T C 5: 36,820,927 T338A probably benign Het
Mbtps1 A T 8: 119,546,125 S94T probably benign Het
Muc3a A T 5: 137,210,081 S205T unknown Het
Nav2 C A 7: 49,545,934 D1019E probably damaging Het
Neurl4 T A 11: 69,903,426 L236* probably null Het
Olfr272 A G 4: 52,911,260 V178A probably benign Het
Plcxd3 T C 15: 4,516,611 probably benign Het
Pprc1 T C 19: 46,071,526 probably benign Het
Prkaa2 T A 4: 105,075,450 N67I probably damaging Het
Prx A G 7: 27,517,258 M534V probably damaging Het
Rps6kc1 C T 1: 190,871,768 R219Q possibly damaging Het
Sbf2 T C 7: 110,378,043 Y628C probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Spata31 A T 13: 64,921,382 Q448L probably damaging Het
Stk35 T C 2: 129,811,235 probably benign Het
Stxbp5 T A 10: 9,838,092 R234S probably damaging Het
Tifab A G 13: 56,176,288 V114A probably benign Het
Tiprl A G 1: 165,228,406 M49T probably benign Het
Tlr12 A G 4: 128,617,752 L235P possibly damaging Het
Tmem57 A G 4: 134,804,507 V617A probably damaging Het
Trim43b A T 9: 89,085,358 C407* probably null Het
Txndc17 C A 11: 72,207,707 F28L probably damaging Het
Vmn2r27 T C 6: 124,200,690 R452G probably damaging Het
Vmn2r3 T A 3: 64,275,117 D387V probably damaging Het
Vps13b T C 15: 35,875,566 I2699T probably damaging Het
Zfp944 G T 17: 22,339,716 Y183* probably null Het
Other mutations in Prom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Prom1 APN 5 44055937 missense probably damaging 1.00
IGL00392:Prom1 APN 5 44007021 critical splice donor site probably null
IGL00771:Prom1 APN 5 44029776 splice site probably benign
IGL00841:Prom1 APN 5 44063116 splice site probably benign
IGL01780:Prom1 APN 5 44029604 splice site probably benign
IGL01991:Prom1 APN 5 44047506 missense probably benign 0.13
IGL02220:Prom1 APN 5 44014789 missense probably damaging 1.00
IGL02350:Prom1 APN 5 44029604 splice site probably benign
IGL02357:Prom1 APN 5 44029604 splice site probably benign
IGL02420:Prom1 APN 5 44063154 missense probably benign 0.15
IGL02468:Prom1 APN 5 44029698 missense probably benign 0.01
IGL02633:Prom1 APN 5 44014775 missense probably benign 0.20
IGL02871:Prom1 APN 5 44029676 missense probably damaging 1.00
IGL02967:Prom1 APN 5 44044398 missense probably damaging 1.00
IGL03033:Prom1 APN 5 44006160 splice site probably null
IGL03072:Prom1 APN 5 44058662 intron probably benign
IGL03149:Prom1 APN 5 44029734 missense probably damaging 0.99
IGL03277:Prom1 APN 5 44032971 nonsense probably null
R1018:Prom1 UTSW 5 44029714 missense probably benign 0.02
R1456:Prom1 UTSW 5 44037623 missense probably damaging 0.96
R1458:Prom1 UTSW 5 44032932 splice site probably benign
R1747:Prom1 UTSW 5 44007031 missense probably benign 0.03
R1772:Prom1 UTSW 5 44011224 missense probably benign 0.00
R2020:Prom1 UTSW 5 44011253 splice site probably benign
R2022:Prom1 UTSW 5 44029726 missense probably benign 0.18
R2091:Prom1 UTSW 5 44014086 splice site probably benign
R2163:Prom1 UTSW 5 44014163 missense possibly damaging 0.72
R2177:Prom1 UTSW 5 44026739 missense possibly damaging 0.67
R3015:Prom1 UTSW 5 44034391 missense probably damaging 1.00
R3022:Prom1 UTSW 5 44047574 missense probably damaging 1.00
R4824:Prom1 UTSW 5 44034390 missense probably damaging 0.98
R4909:Prom1 UTSW 5 44045552 missense probably benign 0.00
R4999:Prom1 UTSW 5 44037534 missense probably benign 0.00
R5082:Prom1 UTSW 5 44000832 unclassified probably null
R5351:Prom1 UTSW 5 44044355 missense probably damaging 1.00
R5401:Prom1 UTSW 5 44000805 missense probably damaging 0.99
R5440:Prom1 UTSW 5 44058646 missense probably benign
R5529:Prom1 UTSW 5 44026768 missense probably damaging 1.00
R5537:Prom1 UTSW 5 44000776 critical splice donor site probably null
R5669:Prom1 UTSW 5 44012943 missense possibly damaging 0.64
R5723:Prom1 UTSW 5 44014894 missense probably benign 0.30
R5778:Prom1 UTSW 5 44007047 missense probably benign 0.13
R5924:Prom1 UTSW 5 44004963 missense probably benign 0.02
R6034:Prom1 UTSW 5 44044408 critical splice acceptor site probably null
R6034:Prom1 UTSW 5 44044408 critical splice acceptor site probably null
R6038:Prom1 UTSW 5 44001793 missense probably damaging 1.00
R6038:Prom1 UTSW 5 44001793 missense probably damaging 1.00
R6145:Prom1 UTSW 5 44029649 missense probably benign 0.05
R6374:Prom1 UTSW 5 44055983 missense probably damaging 1.00
R6542:Prom1 UTSW 5 44037509 missense possibly damaging 0.84
R6645:Prom1 UTSW 5 44047514 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCAGATCACAAGGGCTTGAAAAGATGAC -3'
(R):5'- TTGCTGCTAACTTGTTGCCCAGA -3'

Sequencing Primer
(F):5'- ggaaaagaagaaggggacacag -3'
(R):5'- CCAGAGTATTTACTCTAACGATGCC -3'
Posted On2014-04-13