Incidental Mutation 'R1536:Prx'
ID169529
Institutional Source Beutler Lab
Gene Symbol Prx
Ensembl Gene ENSMUSG00000053198
Gene Nameperiaxin
SynonymsL-Periaxin
MMRRC Submission 039575-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1536 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27499324-27520214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27517258 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 534 (M534V)
Ref Sequence ENSEMBL: ENSMUSP00000096241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065487] [ENSMUST00000098644] [ENSMUST00000108355] [ENSMUST00000125990]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065487
AA Change: M534V

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000066110
Gene: ENSMUSG00000053198
AA Change: M534V

DomainStartEndE-ValueType
PDZ 28 100 6.83e-8 SMART
low complexity region 179 232 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
internal_repeat_3 316 419 9.05e-5 PROSPERO
internal_repeat_2 317 428 7.28e-6 PROSPERO
internal_repeat_1 321 508 8.09e-9 PROSPERO
internal_repeat_1 503 779 8.09e-9 PROSPERO
internal_repeat_2 840 974 7.28e-6 PROSPERO
internal_repeat_3 1176 1268 9.05e-5 PROSPERO
low complexity region 1275 1314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098644
AA Change: M534V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096241
Gene: ENSMUSG00000053198
AA Change: M534V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDZ 28 100 6.83e-8 SMART
low complexity region 179 232 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
internal_repeat_3 316 419 5.13e-5 PROSPERO
internal_repeat_2 317 428 3.79e-6 PROSPERO
internal_repeat_1 321 508 3.34e-9 PROSPERO
internal_repeat_1 503 779 3.34e-9 PROSPERO
internal_repeat_2 840 974 3.79e-6 PROSPERO
internal_repeat_3 1176 1268 5.13e-5 PROSPERO
low complexity region 1275 1314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108355
SMART Domains Protein: ENSMUSP00000103992
Gene: ENSMUSG00000053198

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDZ 28 100 6.83e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125990
AA Change: M395V

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display locomotor problems as well as difficulty eating and breathing. Demyelination of peripheral nerves develops with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,970,665 I3F probably benign Het
4930590J08Rik A G 6: 91,917,035 N211S probably benign Het
A2ml1 A T 6: 128,547,233 Y1145* probably null Het
Abca7 A G 10: 80,014,230 D1972G probably benign Het
Adamts19 A T 18: 59,052,615 D1187V probably damaging Het
Adcy6 G C 15: 98,600,007 I421M probably damaging Het
Afap1 C A 5: 35,974,491 H387Q probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Auts2 C T 5: 131,487,463 probably benign Het
Cbll1 T C 12: 31,487,856 D300G probably damaging Het
Cd200r4 A T 16: 44,833,049 T61S possibly damaging Het
Chmp4c G T 3: 10,389,684 V207L probably benign Het
Cntn5 T C 9: 9,976,316 T413A possibly damaging Het
Cox7a2 T A 9: 79,758,581 probably null Het
Cwc27 A G 13: 104,797,306 L236P probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Dst T A 1: 34,260,372 probably benign Het
Ear1 T A 14: 43,819,126 H95L probably damaging Het
Enpp1 T A 10: 24,641,834 H898L probably benign Het
Entpd5 G A 12: 84,382,295 R321* probably null Het
Ercc6l2 C A 13: 63,824,871 N177K possibly damaging Het
Ergic1 T C 17: 26,641,706 probably null Het
Erich6 A T 3: 58,626,598 I336N probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galnt3 A T 2: 66,084,206 D622E probably damaging Het
Gjd4 T A 18: 9,280,569 T170S probably damaging Het
Gm5611 G A 9: 17,030,607 noncoding transcript Het
Gpc5 T A 14: 115,399,250 N448K probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Man2b2 T C 5: 36,820,927 T338A probably benign Het
Mbtps1 A T 8: 119,546,125 S94T probably benign Het
Muc3a A T 5: 137,210,081 S205T unknown Het
Nav2 C A 7: 49,545,934 D1019E probably damaging Het
Neurl4 T A 11: 69,903,426 L236* probably null Het
Olfr272 A G 4: 52,911,260 V178A probably benign Het
Plcxd3 T C 15: 4,516,611 probably benign Het
Pprc1 T C 19: 46,071,526 probably benign Het
Prkaa2 T A 4: 105,075,450 N67I probably damaging Het
Prom1 T A 5: 44,018,353 Y508F probably benign Het
Rps6kc1 C T 1: 190,871,768 R219Q possibly damaging Het
Sbf2 T C 7: 110,378,043 Y628C probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Spata31 A T 13: 64,921,382 Q448L probably damaging Het
Stk35 T C 2: 129,811,235 probably benign Het
Stxbp5 T A 10: 9,838,092 R234S probably damaging Het
Tifab A G 13: 56,176,288 V114A probably benign Het
Tiprl A G 1: 165,228,406 M49T probably benign Het
Tlr12 A G 4: 128,617,752 L235P possibly damaging Het
Tmem57 A G 4: 134,804,507 V617A probably damaging Het
Trim43b A T 9: 89,085,358 C407* probably null Het
Txndc17 C A 11: 72,207,707 F28L probably damaging Het
Vmn2r27 T C 6: 124,200,690 R452G probably damaging Het
Vmn2r3 T A 3: 64,275,117 D387V probably damaging Het
Vps13b T C 15: 35,875,566 I2699T probably damaging Het
Zfp944 G T 17: 22,339,716 Y183* probably null Het
Other mutations in Prx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Prx APN 7 27519419 missense probably benign 0.12
IGL01702:Prx APN 7 27519787 missense probably benign 0.00
IGL02012:Prx APN 7 27517901 missense probably damaging 1.00
IGL02214:Prx APN 7 27518912 missense probably damaging 1.00
IGL02498:Prx APN 7 27518072 missense probably damaging 1.00
IGL03029:Prx APN 7 27508061 nonsense probably null
R0522:Prx UTSW 7 27518195 missense probably damaging 0.99
R0655:Prx UTSW 7 27517421 missense probably damaging 1.00
R0904:Prx UTSW 7 27518294 missense probably damaging 1.00
R1161:Prx UTSW 7 27519677 missense probably damaging 1.00
R1170:Prx UTSW 7 27518007 nonsense probably null
R1270:Prx UTSW 7 27518930 missense probably damaging 0.96
R1470:Prx UTSW 7 27517601 missense probably benign 0.19
R1470:Prx UTSW 7 27517601 missense probably benign 0.19
R1721:Prx UTSW 7 27517523 missense probably benign 0.19
R1815:Prx UTSW 7 27516665 missense probably damaging 1.00
R1848:Prx UTSW 7 27518888 missense possibly damaging 0.70
R1894:Prx UTSW 7 27519110 missense possibly damaging 0.68
R2179:Prx UTSW 7 27517985 missense probably benign
R2207:Prx UTSW 7 27516788 missense probably damaging 1.00
R2312:Prx UTSW 7 27516626 missense possibly damaging 0.87
R2356:Prx UTSW 7 27507859 start gained probably benign
R2519:Prx UTSW 7 27518243 missense probably benign 0.43
R2912:Prx UTSW 7 27516229 missense probably damaging 1.00
R4717:Prx UTSW 7 27516727 missense probably benign 0.07
R4868:Prx UTSW 7 27517579 missense probably benign 0.01
R5153:Prx UTSW 7 27518476 missense probably damaging 1.00
R5418:Prx UTSW 7 27517274 missense probably damaging 0.99
R5653:Prx UTSW 7 27517604 missense probably damaging 1.00
R5895:Prx UTSW 7 27515284 missense probably damaging 1.00
R6022:Prx UTSW 7 27517573 missense probably damaging 1.00
R6112:Prx UTSW 7 27516548 missense probably damaging 1.00
R6223:Prx UTSW 7 27516836 missense probably damaging 1.00
R6560:Prx UTSW 7 27515321 missense probably damaging 1.00
R6888:Prx UTSW 7 27519634 missense possibly damaging 0.73
R7530:Prx UTSW 7 27507972 missense probably damaging 1.00
X0028:Prx UTSW 7 27517733 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGCCATTCCAGATGTGCAAC -3'
(R):5'- CTTCACCTCAGACACTTTGGGCAG -3'

Sequencing Primer
(F):5'- TGCAACTCCCTGAGGTACAG -3'
(R):5'- CTGGTAGCTTCATCTCTGGAAC -3'
Posted On2014-04-13