Incidental Mutation 'R1537:Mcm10'
ID169567
Institutional Source Beutler Lab
Gene Symbol Mcm10
Ensembl Gene ENSMUSG00000026669
Gene Nameminichromosome maintenance 10 replication initiation factor
SynonymsC330019M07Rik, 2410041F14Rik
MMRRC Submission 039576-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1537 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location4989714-5012791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4998780 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 542 (T542I)
Ref Sequence ENSEMBL: ENSMUSP00000100050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027980] [ENSMUST00000102985]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027980
AA Change: T542I

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027980
Gene: ENSMUSG00000026669
AA Change: T542I

DomainStartEndE-ValueType
coiled coil region 102 138 N/A INTRINSIC
low complexity region 218 228 N/A INTRINSIC
Pfam:zf-primase 398 443 2e-21 PFAM
low complexity region 480 493 N/A INTRINSIC
Mcm10 538 883 2.27e-184 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102985
AA Change: T542I

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000100050
Gene: ENSMUSG00000026669
AA Change: T542I

DomainStartEndE-ValueType
coiled coil region 102 138 N/A INTRINSIC
low complexity region 218 228 N/A INTRINSIC
Pfam:zf-primase 398 443 3.7e-21 PFAM
low complexity region 480 493 N/A INTRINSIC
Mcm10 538 883 2.27e-184 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151533
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre-RC) and it may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein can interact with MCM2 and MCM6, as well as with the origin recognition protein ORC2. It is regulated by proteolysis and phosphorylation in a cell cycle-dependent manner. Studies of a similar protein in Xenopus suggest that the chromatin binding of this protein at the onset of DNA replication is after pre-RC assembly and before origin unwinding. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced embryonic cell proliferation and early embryonic letahlity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,475 H86L possibly damaging Het
2610507B11Rik T A 11: 78,289,343 Y2150N probably damaging Het
4930519G04Rik A G 5: 114,870,217 T31A probably benign Het
Ahcyl1 A G 3: 107,696,189 F30S probably benign Het
Alox5ap G A 5: 149,265,183 probably null Het
Amtn A G 5: 88,378,870 S53G probably null Het
Arap3 A T 18: 37,989,684 probably null Het
Ash1l T A 3: 89,072,476 V2769E probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bhlha9 C T 11: 76,672,631 S28L probably benign Het
Bmpr2 A G 1: 59,868,126 T793A probably benign Het
Ccdc80 G A 16: 45,095,936 A352T probably benign Het
Chst2 A T 9: 95,406,141 F51I probably benign Het
Col14a1 A G 15: 55,380,767 N412S unknown Het
Dclk2 T C 3: 86,806,184 I451V probably damaging Het
Ddb2 A G 2: 91,234,889 S64P probably benign Het
Diaph1 A G 18: 37,896,093 probably null Het
Dusp4 G T 8: 34,818,416 R277L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Garem1 A T 18: 21,168,874 probably null Het
Gnpat A G 8: 124,870,816 E39G probably damaging Het
Golgb1 A T 16: 36,898,788 Q352L possibly damaging Het
Hdlbp T C 1: 93,417,374 D803G probably benign Het
Hps1 A G 19: 42,759,704 probably null Het
Ilvbl G A 10: 78,579,731 R327H probably benign Het
Itpr3 A G 17: 27,114,147 D1911G possibly damaging Het
Lmo7 T A 14: 101,929,264 probably benign Het
Med1 A G 11: 98,160,946 V497A probably damaging Het
Mn1 G A 5: 111,454,780 A1295T probably damaging Het
Myh7b A C 2: 155,631,787 D1580A probably damaging Het
Naa20 A G 2: 145,912,518 I101V probably benign Het
Nav3 T C 10: 109,866,985 Y229C probably damaging Het
Obscn T C 11: 59,000,749 R6986G unknown Het
Olfr573-ps1 G A 7: 102,942,340 T79I probably damaging Het
Olfr878 A G 9: 37,919,274 I211V probably benign Het
P2rx3 A G 2: 85,023,481 probably null Het
Papd4 C T 13: 93,175,568 G208D probably damaging Het
Pcdhac2 G A 18: 37,146,486 G840R possibly damaging Het
Pclo A G 5: 14,712,475 N3654S unknown Het
Pcnx2 T A 8: 125,877,449 E689D possibly damaging Het
Pds5a A G 5: 65,647,121 S532P probably benign Het
Phf1 G A 17: 26,935,398 probably null Het
Pkp4 G A 2: 59,214,803 V41M probably damaging Het
Prlr T G 15: 10,328,278 probably null Het
Prr12 G T 7: 45,028,942 A1954D unknown Het
Prtg A G 9: 72,809,757 T127A probably benign Het
Ptprh A G 7: 4,549,699 L884P probably damaging Het
Rnf170 T A 8: 26,139,048 D183E probably benign Het
Rrp12 A T 19: 41,886,803 H339Q probably damaging Het
Rubcnl T G 14: 75,040,827 S350R possibly damaging Het
Sgo2b T A 8: 63,926,502 T1099S possibly damaging Het
Ska2 T C 11: 87,116,119 S17P probably damaging Het
Slc38a2 A G 15: 96,693,153 I243T possibly damaging Het
Sptan1 T A 2: 30,026,022 D2007E possibly damaging Het
Taar5 T A 10: 23,970,722 L6H probably benign Het
Tbata G T 10: 61,183,491 probably null Het
Tmem107 T C 11: 69,072,458 S98P probably damaging Het
Tpst2 A G 5: 112,308,420 D275G possibly damaging Het
Ttc28 G T 5: 111,285,318 G2073W probably damaging Het
Ttc7 T C 17: 87,322,463 V291A possibly damaging Het
Vps13b T A 15: 35,792,181 N2198K possibly damaging Het
Wdr37 A T 13: 8,837,003 D249E probably benign Het
Wdr63 T C 3: 146,042,749 E870G probably damaging Het
Xirp2 G T 2: 67,510,013 C866F probably damaging Het
Zfp990 A G 4: 145,536,996 E188G possibly damaging Het
Zkscan2 A G 7: 123,499,841 S43P possibly damaging Het
Zscan5b A G 7: 6,233,851 R200G probably benign Het
Other mutations in Mcm10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Mcm10 APN 2 5008628 missense probably benign 0.00
IGL02028:Mcm10 APN 2 5008700 missense possibly damaging 0.95
IGL02672:Mcm10 APN 2 5001281 missense probably benign 0.00
IGL03352:Mcm10 APN 2 4994596 missense probably damaging 1.00
R0055:Mcm10 UTSW 2 4991407 missense probably damaging 1.00
R0055:Mcm10 UTSW 2 4991407 missense probably damaging 1.00
R0320:Mcm10 UTSW 2 5004086 missense probably benign
R0379:Mcm10 UTSW 2 5008623 missense probably benign 0.05
R0385:Mcm10 UTSW 2 5004154 missense possibly damaging 0.82
R0519:Mcm10 UTSW 2 5008545 missense probably benign
R1597:Mcm10 UTSW 2 4998752 missense probably damaging 1.00
R1727:Mcm10 UTSW 2 5006525 missense probably benign 0.10
R1758:Mcm10 UTSW 2 5004050 missense probably damaging 1.00
R1997:Mcm10 UTSW 2 4993760 missense probably damaging 1.00
R3618:Mcm10 UTSW 2 4997102 critical splice donor site probably null
R4005:Mcm10 UTSW 2 5001003 missense probably damaging 1.00
R4870:Mcm10 UTSW 2 5004159 missense probably damaging 1.00
R5302:Mcm10 UTSW 2 5007370 missense probably benign 0.12
R5488:Mcm10 UTSW 2 4992118 missense probably damaging 1.00
R6921:Mcm10 UTSW 2 5000935 missense probably benign 0.00
X0020:Mcm10 UTSW 2 5007148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCAAGAGGGCTGATGCTGAGATG -3'
(R):5'- TCATGCATATTCCAGAAGTGGCACG -3'

Sequencing Primer
(F):5'- CTGAGATGGACTGGATGGC -3'
(R):5'- aacgactgctcttcctgac -3'
Posted On2014-04-13