Incidental Mutation 'R1537:Sptan1'
ID169568
Institutional Source Beutler Lab
Gene Symbol Sptan1
Ensembl Gene ENSMUSG00000057738
Gene Namespectrin alpha, non-erythrocytic 1
Synonymsalpha-fodrin, Spna2, 2610027H02Rik, Spna-2
MMRRC Submission 039576-MU
Accession Numbers

Ncbi RefSeq: NM_001076554.2, NM_001177667.1, NM_001177668.1; MGI:98386

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1537 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location29965560-30031451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30026022 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 2007 (D2007E)
Ref Sequence ENSEMBL: ENSMUSP00000109348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000129241]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046257
AA Change: D2002E

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738
AA Change: D2002E

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1635 9.65e-30 SMART
SPEC 1641 1741 2.32e-32 SMART
SPEC 1747 1847 6.98e-36 SMART
SPEC 1853 1953 1.53e-32 SMART
SPEC 1959 2060 6.23e-24 SMART
SPEC 2074 2174 2.08e-11 SMART
SPEC 2188 2289 1.07e-4 SMART
EFh 2307 2335 5.78e-7 SMART
EFh 2350 2378 3.85e-3 SMART
efhand_Ca_insen 2382 2451 6.74e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000095083
AA Change: D2022E

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738
AA Change: D2022E

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1655 9.65e-30 SMART
SPEC 1661 1761 2.32e-32 SMART
SPEC 1767 1867 6.98e-36 SMART
SPEC 1873 1973 1.53e-32 SMART
SPEC 1979 2080 6.23e-24 SMART
SPEC 2094 2194 2.08e-11 SMART
SPEC 2208 2309 1.07e-4 SMART
EFh 2327 2355 5.78e-7 SMART
EFh 2370 2398 3.85e-3 SMART
efhand_Ca_insen 2402 2471 6.74e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100225
AA Change: D2027E

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738
AA Change: D2027E

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1660 2.06e-24 SMART
SPEC 1666 1766 2.32e-32 SMART
SPEC 1772 1872 6.98e-36 SMART
SPEC 1878 1978 1.53e-32 SMART
SPEC 1984 2085 6.23e-24 SMART
SPEC 2099 2199 2.08e-11 SMART
SPEC 2213 2314 1.07e-4 SMART
EFh 2332 2360 5.78e-7 SMART
EFh 2375 2403 3.85e-3 SMART
efhand_Ca_insen 2407 2476 6.74e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113717
AA Change: D2007E

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738
AA Change: D2007E

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2294 1.07e-4 SMART
EFh 2312 2340 5.78e-7 SMART
EFh 2355 2383 3.85e-3 SMART
efhand_Ca_insen 2387 2456 6.74e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113719
AA Change: D2007E

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738
AA Change: D2007E

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2315 3.27e0 SMART
EFh 2333 2361 5.78e-7 SMART
EFh 2376 2404 3.85e-3 SMART
efhand_Ca_insen 2408 2477 6.74e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124494
Predicted Effect unknown
Transcript: ENSMUST00000129241
AA Change: D2027E
SMART Domains Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738
AA Change: D2027E

DomainStartEndE-ValueType
Pfam:Spectrin 1 65 9.9e-10 PFAM
SPEC 78 178 2.08e-11 SMART
SPEC 192 314 3.27e0 SMART
EFh 332 360 5.78e-7 SMART
EFh 375 403 3.85e-3 SMART
efhand_Ca_insen 407 476 6.74e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201758
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype Strain: 3714925; 4330132
Lethality: E12-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are a family of filamentous cytoskeletal proteins that function as essential scaffold proteins that stabilize the plasma membrane and organize intracellular organelles. Spectrins are composed of alpha and beta dimers that associate to form tetramers linked in a head-to-head arrangement. This gene encodes an alpha spectrin that is specifically expressed in nonerythrocytic cells. The encoded protein has been implicated in other cellular functions including DNA repair and cell cycle regulation. Mutations in this gene are the cause of early infantile epileptic encephalopathy-5. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous deletion of the exons encoding the CCC region are normal. Mice homozygous for a gene trap allele exhibit embryonic lethality and abnormal nervous system, heart and craniofacial morphology. [provided by MGI curators]
Allele List at MGI

All alleles(76) : Targeted(1) Gene trapped(75)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,475 H86L possibly damaging Het
2610507B11Rik T A 11: 78,289,343 Y2150N probably damaging Het
4930519G04Rik A G 5: 114,870,217 T31A probably benign Het
Ahcyl1 A G 3: 107,696,189 F30S probably benign Het
Alox5ap G A 5: 149,265,183 probably null Het
Amtn A G 5: 88,378,870 S53G probably null Het
Arap3 A T 18: 37,989,684 probably null Het
Ash1l T A 3: 89,072,476 V2769E probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bhlha9 C T 11: 76,672,631 S28L probably benign Het
Bmpr2 A G 1: 59,868,126 T793A probably benign Het
Ccdc80 G A 16: 45,095,936 A352T probably benign Het
Chst2 A T 9: 95,406,141 F51I probably benign Het
Col14a1 A G 15: 55,380,767 N412S unknown Het
Dclk2 T C 3: 86,806,184 I451V probably damaging Het
Ddb2 A G 2: 91,234,889 S64P probably benign Het
Diaph1 A G 18: 37,896,093 probably null Het
Dusp4 G T 8: 34,818,416 R277L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Garem1 A T 18: 21,168,874 probably null Het
Gnpat A G 8: 124,870,816 E39G probably damaging Het
Golgb1 A T 16: 36,898,788 Q352L possibly damaging Het
Hdlbp T C 1: 93,417,374 D803G probably benign Het
Hps1 A G 19: 42,759,704 probably null Het
Ilvbl G A 10: 78,579,731 R327H probably benign Het
Itpr3 A G 17: 27,114,147 D1911G possibly damaging Het
Lmo7 T A 14: 101,929,264 probably benign Het
Mcm10 G A 2: 4,998,780 T542I possibly damaging Het
Med1 A G 11: 98,160,946 V497A probably damaging Het
Mn1 G A 5: 111,454,780 A1295T probably damaging Het
Myh7b A C 2: 155,631,787 D1580A probably damaging Het
Naa20 A G 2: 145,912,518 I101V probably benign Het
Nav3 T C 10: 109,866,985 Y229C probably damaging Het
Obscn T C 11: 59,000,749 R6986G unknown Het
Olfr573-ps1 G A 7: 102,942,340 T79I probably damaging Het
Olfr878 A G 9: 37,919,274 I211V probably benign Het
P2rx3 A G 2: 85,023,481 probably null Het
Papd4 C T 13: 93,175,568 G208D probably damaging Het
Pcdhac2 G A 18: 37,146,486 G840R possibly damaging Het
Pclo A G 5: 14,712,475 N3654S unknown Het
Pcnx2 T A 8: 125,877,449 E689D possibly damaging Het
Pds5a A G 5: 65,647,121 S532P probably benign Het
Phf1 G A 17: 26,935,398 probably null Het
Pkp4 G A 2: 59,214,803 V41M probably damaging Het
Prlr T G 15: 10,328,278 probably null Het
Prr12 G T 7: 45,028,942 A1954D unknown Het
Prtg A G 9: 72,809,757 T127A probably benign Het
Ptprh A G 7: 4,549,699 L884P probably damaging Het
Rnf170 T A 8: 26,139,048 D183E probably benign Het
Rrp12 A T 19: 41,886,803 H339Q probably damaging Het
Rubcnl T G 14: 75,040,827 S350R possibly damaging Het
Sgo2b T A 8: 63,926,502 T1099S possibly damaging Het
Ska2 T C 11: 87,116,119 S17P probably damaging Het
Slc38a2 A G 15: 96,693,153 I243T possibly damaging Het
Taar5 T A 10: 23,970,722 L6H probably benign Het
Tbata G T 10: 61,183,491 probably null Het
Tmem107 T C 11: 69,072,458 S98P probably damaging Het
Tpst2 A G 5: 112,308,420 D275G possibly damaging Het
Ttc28 G T 5: 111,285,318 G2073W probably damaging Het
Ttc7 T C 17: 87,322,463 V291A possibly damaging Het
Vps13b T A 15: 35,792,181 N2198K possibly damaging Het
Wdr37 A T 13: 8,837,003 D249E probably benign Het
Wdr63 T C 3: 146,042,749 E870G probably damaging Het
Xirp2 G T 2: 67,510,013 C866F probably damaging Het
Zfp990 A G 4: 145,536,996 E188G possibly damaging Het
Zkscan2 A G 7: 123,499,841 S43P possibly damaging Het
Zscan5b A G 7: 6,233,851 R200G probably benign Het
Other mutations in Sptan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Sptan1 APN 2 29993956 critical splice donor site probably null
IGL00932:Sptan1 APN 2 30015610 missense probably damaging 1.00
IGL00945:Sptan1 APN 2 30000071 splice site probably benign
IGL01070:Sptan1 APN 2 30014173 critical splice donor site probably null
IGL01625:Sptan1 APN 2 30026114 missense probably damaging 1.00
IGL01657:Sptan1 APN 2 30018479 missense probably benign 0.12
IGL01795:Sptan1 APN 2 30018489 missense probably benign 0.07
IGL01982:Sptan1 APN 2 30019968 missense probably damaging 1.00
IGL02040:Sptan1 APN 2 30013713 missense probably benign 0.43
IGL02158:Sptan1 APN 2 30030324 missense probably damaging 0.97
IGL02370:Sptan1 APN 2 30030740 missense probably damaging 0.99
IGL02507:Sptan1 APN 2 30016055 missense probably damaging 1.00
IGL02552:Sptan1 APN 2 30018474 missense probably damaging 0.99
IGL02690:Sptan1 APN 2 29998183 missense possibly damaging 0.78
IGL02715:Sptan1 APN 2 29978576 missense probably benign 0.03
IGL02725:Sptan1 APN 2 29996043 missense probably damaging 0.99
IGL03033:Sptan1 APN 2 29991033 missense probably damaging 1.00
IGL03304:Sptan1 APN 2 29986493 missense probably damaging 1.00
IGL03405:Sptan1 APN 2 30025581 missense probably damaging 0.99
R0058:Sptan1 UTSW 2 29993696 splice site probably null
R0058:Sptan1 UTSW 2 29993696 splice site probably null
R0066:Sptan1 UTSW 2 30003667 splice site probably benign
R0066:Sptan1 UTSW 2 30003667 splice site probably benign
R0071:Sptan1 UTSW 2 30003342 nonsense probably null
R0071:Sptan1 UTSW 2 30003342 nonsense probably null
R0094:Sptan1 UTSW 2 30006623 missense probably benign 0.37
R0230:Sptan1 UTSW 2 30010692 splice site probably benign
R0242:Sptan1 UTSW 2 30018401 missense probably benign 0.00
R0242:Sptan1 UTSW 2 30018401 missense probably benign 0.00
R0366:Sptan1 UTSW 2 29992752 splice site probably null
R0368:Sptan1 UTSW 2 29993915 missense probably benign 0.29
R0396:Sptan1 UTSW 2 29991033 missense probably damaging 1.00
R0423:Sptan1 UTSW 2 30028672 missense probably null
R0448:Sptan1 UTSW 2 30026810 missense probably damaging 1.00
R0485:Sptan1 UTSW 2 30013848 splice site probably benign
R0580:Sptan1 UTSW 2 30007575 missense probably damaging 0.99
R0739:Sptan1 UTSW 2 30013518 missense probably damaging 1.00
R0924:Sptan1 UTSW 2 30016028 missense probably damaging 0.98
R0930:Sptan1 UTSW 2 30016028 missense probably damaging 0.98
R0961:Sptan1 UTSW 2 29980063 splice site probably null
R1352:Sptan1 UTSW 2 30021187 splice site probably benign
R1456:Sptan1 UTSW 2 29980203 critical splice donor site probably null
R1542:Sptan1 UTSW 2 30027127 missense probably damaging 1.00
R1612:Sptan1 UTSW 2 30003336 missense probably damaging 1.00
R1623:Sptan1 UTSW 2 29986420 missense probably damaging 0.96
R1834:Sptan1 UTSW 2 29992001 splice site probably benign
R1879:Sptan1 UTSW 2 29995528 missense probably damaging 1.00
R1893:Sptan1 UTSW 2 30020460 missense probably damaging 0.98
R1914:Sptan1 UTSW 2 30011036 missense probably benign 0.00
R1915:Sptan1 UTSW 2 30011036 missense probably benign 0.00
R2022:Sptan1 UTSW 2 30007561 missense probably damaging 0.96
R2050:Sptan1 UTSW 2 30002238 missense probably benign
R2103:Sptan1 UTSW 2 30030471 missense probably damaging 1.00
R2162:Sptan1 UTSW 2 30018576 splice site probably benign
R2931:Sptan1 UTSW 2 30018488 missense probably benign
R3726:Sptan1 UTSW 2 30018419 missense possibly damaging 0.59
R4170:Sptan1 UTSW 2 30030025 missense possibly damaging 0.93
R4235:Sptan1 UTSW 2 30026588 missense probably damaging 1.00
R4378:Sptan1 UTSW 2 30025569 missense probably damaging 1.00
R4424:Sptan1 UTSW 2 30029709 intron probably benign
R4718:Sptan1 UTSW 2 30031062 missense probably damaging 1.00
R4777:Sptan1 UTSW 2 29996435 missense probably damaging 0.98
R4849:Sptan1 UTSW 2 30011042 missense probably damaging 1.00
R5158:Sptan1 UTSW 2 29978443 missense probably damaging 1.00
R5180:Sptan1 UTSW 2 29993724 intron probably benign
R5181:Sptan1 UTSW 2 29993724 intron probably benign
R5383:Sptan1 UTSW 2 30011328 missense probably damaging 1.00
R5573:Sptan1 UTSW 2 29986492 nonsense probably null
R5592:Sptan1 UTSW 2 29986719 intron probably benign
R5639:Sptan1 UTSW 2 29990993 nonsense probably null
R5801:Sptan1 UTSW 2 30030601 splice site probably null
R5947:Sptan1 UTSW 2 29994367 critical splice donor site probably null
R6056:Sptan1 UTSW 2 29996782 missense probably benign 0.36
R6090:Sptan1 UTSW 2 29993887 missense probably damaging 1.00
R6146:Sptan1 UTSW 2 30004523 missense probably benign 0.01
R6254:Sptan1 UTSW 2 30007549 missense possibly damaging 0.93
R6366:Sptan1 UTSW 2 30020455 missense possibly damaging 0.47
R6378:Sptan1 UTSW 2 30018515 missense probably damaging 1.00
R6521:Sptan1 UTSW 2 30020455 missense possibly damaging 0.47
R6877:Sptan1 UTSW 2 30030973 missense probably damaging 0.99
X0028:Sptan1 UTSW 2 30020030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTTTGCCCACAGCTTGAATG -3'
(R):5'- AAATGACTCTGGGCCTCCAGCAAC -3'

Sequencing Primer
(F):5'- GGCCAAAGATGTAACCATTGC -3'
(R):5'- AGCAACTTCTTCTTCCGGGTAG -3'
Posted On2014-04-13