Incidental Mutation 'R1537:P2rx3'
ID169572
Institutional Source Beutler Lab
Gene Symbol P2rx3
Ensembl Gene ENSMUSG00000027071
Gene Namepurinergic receptor P2X, ligand-gated ion channel, 3
Synonyms4930513E20Rik, P2X3
MMRRC Submission 039576-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R1537 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location84998583-85037462 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 85023481 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028465] [ENSMUST00000111613] [ENSMUST00000111616]
Predicted Effect probably null
Transcript: ENSMUST00000028465
SMART Domains Protein: ENSMUSP00000028465
Gene: ENSMUSG00000027071

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 367 1.6e-151 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111613
SMART Domains Protein: ENSMUSP00000107240
Gene: ENSMUSG00000027071

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 372 4.7e-162 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111616
SMART Domains Protein: ENSMUSP00000107243
Gene: ENSMUSG00000027071

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 91 1.2e-32 PFAM
Pfam:P2X_receptor 86 350 3.3e-113 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145285
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and may transduce ATP-evoked nociceptor activation. Mouse studies suggest that this receptor is important for peripheral pain responses, and also participates in pathways controlling urinary bladder volume reflexes. It is possible that the development of selective antagonists for this receptor may have a therapeutic potential in pain relief and in the treatment of disorders of urine storage. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show normal ventilatory responses to hypoxia. Mice homozygous for a reporter allele show loss of rapidly desensitizing ATP-gated cation currents in dorsal root ganglion neurons, reduced formalin-evoked pain behavior, and enhanced thermal hyperalgesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,475 H86L possibly damaging Het
2610507B11Rik T A 11: 78,289,343 Y2150N probably damaging Het
4930519G04Rik A G 5: 114,870,217 T31A probably benign Het
Ahcyl1 A G 3: 107,696,189 F30S probably benign Het
Alox5ap G A 5: 149,265,183 probably null Het
Amtn A G 5: 88,378,870 S53G probably null Het
Arap3 A T 18: 37,989,684 probably null Het
Ash1l T A 3: 89,072,476 V2769E probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bhlha9 C T 11: 76,672,631 S28L probably benign Het
Bmpr2 A G 1: 59,868,126 T793A probably benign Het
Ccdc80 G A 16: 45,095,936 A352T probably benign Het
Chst2 A T 9: 95,406,141 F51I probably benign Het
Col14a1 A G 15: 55,380,767 N412S unknown Het
Dclk2 T C 3: 86,806,184 I451V probably damaging Het
Ddb2 A G 2: 91,234,889 S64P probably benign Het
Diaph1 A G 18: 37,896,093 probably null Het
Dusp4 G T 8: 34,818,416 R277L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Garem1 A T 18: 21,168,874 probably null Het
Gnpat A G 8: 124,870,816 E39G probably damaging Het
Golgb1 A T 16: 36,898,788 Q352L possibly damaging Het
Hdlbp T C 1: 93,417,374 D803G probably benign Het
Hps1 A G 19: 42,759,704 probably null Het
Ilvbl G A 10: 78,579,731 R327H probably benign Het
Itpr3 A G 17: 27,114,147 D1911G possibly damaging Het
Lmo7 T A 14: 101,929,264 probably benign Het
Mcm10 G A 2: 4,998,780 T542I possibly damaging Het
Med1 A G 11: 98,160,946 V497A probably damaging Het
Mn1 G A 5: 111,454,780 A1295T probably damaging Het
Myh7b A C 2: 155,631,787 D1580A probably damaging Het
Naa20 A G 2: 145,912,518 I101V probably benign Het
Nav3 T C 10: 109,866,985 Y229C probably damaging Het
Obscn T C 11: 59,000,749 R6986G unknown Het
Olfr573-ps1 G A 7: 102,942,340 T79I probably damaging Het
Olfr878 A G 9: 37,919,274 I211V probably benign Het
Papd4 C T 13: 93,175,568 G208D probably damaging Het
Pcdhac2 G A 18: 37,146,486 G840R possibly damaging Het
Pclo A G 5: 14,712,475 N3654S unknown Het
Pcnx2 T A 8: 125,877,449 E689D possibly damaging Het
Pds5a A G 5: 65,647,121 S532P probably benign Het
Phf1 G A 17: 26,935,398 probably null Het
Pkp4 G A 2: 59,214,803 V41M probably damaging Het
Prlr T G 15: 10,328,278 probably null Het
Prr12 G T 7: 45,028,942 A1954D unknown Het
Prtg A G 9: 72,809,757 T127A probably benign Het
Ptprh A G 7: 4,549,699 L884P probably damaging Het
Rnf170 T A 8: 26,139,048 D183E probably benign Het
Rrp12 A T 19: 41,886,803 H339Q probably damaging Het
Rubcnl T G 14: 75,040,827 S350R possibly damaging Het
Sgo2b T A 8: 63,926,502 T1099S possibly damaging Het
Ska2 T C 11: 87,116,119 S17P probably damaging Het
Slc38a2 A G 15: 96,693,153 I243T possibly damaging Het
Sptan1 T A 2: 30,026,022 D2007E possibly damaging Het
Taar5 T A 10: 23,970,722 L6H probably benign Het
Tbata G T 10: 61,183,491 probably null Het
Tmem107 T C 11: 69,072,458 S98P probably damaging Het
Tpst2 A G 5: 112,308,420 D275G possibly damaging Het
Ttc28 G T 5: 111,285,318 G2073W probably damaging Het
Ttc7 T C 17: 87,322,463 V291A possibly damaging Het
Vps13b T A 15: 35,792,181 N2198K possibly damaging Het
Wdr37 A T 13: 8,837,003 D249E probably benign Het
Wdr63 T C 3: 146,042,749 E870G probably damaging Het
Xirp2 G T 2: 67,510,013 C866F probably damaging Het
Zfp990 A G 4: 145,536,996 E188G possibly damaging Het
Zkscan2 A G 7: 123,499,841 S43P possibly damaging Het
Zscan5b A G 7: 6,233,851 R200G probably benign Het
Other mutations in P2rx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:P2rx3 APN 2 85035272 missense probably damaging 1.00
IGL01775:P2rx3 APN 2 85024157 missense probably benign
IGL01897:P2rx3 APN 2 85023481 critical splice donor site probably benign
IGL02399:P2rx3 APN 2 85023227 missense probably benign
R0928:P2rx3 UTSW 2 85035298 start codon destroyed probably null 0.98
R1428:P2rx3 UTSW 2 85024950 missense possibly damaging 0.91
R1678:P2rx3 UTSW 2 85022467 missense possibly damaging 0.90
R4332:P2rx3 UTSW 2 85024861 missense probably benign 0.25
R4897:P2rx3 UTSW 2 85024926 missense probably damaging 1.00
R5052:P2rx3 UTSW 2 84999024 missense probably benign 0.01
R5903:P2rx3 UTSW 2 85000727 missense possibly damaging 0.93
R5917:P2rx3 UTSW 2 85035247 missense probably damaging 1.00
R6614:P2rx3 UTSW 2 85035199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAAACGGATGCTGTTCTTGATG -3'
(R):5'- GGCTTCAAAGCCCTCCTAGAAGTG -3'

Sequencing Primer
(F):5'- TGAAAATGGTGAAGTTCTCGGC -3'
(R):5'- cagaggcaaggaagaaggg -3'
Posted On2014-04-13