Incidental Mutation 'R1537:Dclk2'
ID169577
Institutional Source Beutler Lab
Gene Symbol Dclk2
Ensembl Gene ENSMUSG00000028078
Gene Namedoublecortin-like kinase 2
SynonymsDcamkl2, Click-II, 6330415M09Rik
MMRRC Submission 039576-MU
Accession Numbers

Genbank: NM_027539; MGI: 1918012

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1537 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location86786151-86920852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86806184 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 451 (I451V)
Ref Sequence ENSEMBL: ENSMUSP00000142267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029719] [ENSMUST00000191752] [ENSMUST00000192773] [ENSMUST00000193632] [ENSMUST00000194452] [ENSMUST00000195561]
Predicted Effect probably benign
Transcript: ENSMUST00000029719
AA Change: I452V

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000029719
Gene: ENSMUSG00000028078
AA Change: I452V

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 393 650 4.96e-101 SMART
low complexity region 718 740 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191752
AA Change: I452V

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141707
Gene: ENSMUSG00000028078
AA Change: I452V

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 393 646 2.4e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192773
AA Change: I451V

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141567
Gene: ENSMUSG00000028078
AA Change: I451V

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 1.1e-44 SMART
DCX 191 279 9.9e-37 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 392 641 8.6e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193632
AA Change: I468V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141866
Gene: ENSMUSG00000028078
AA Change: I468V

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 1.1e-44 SMART
DCX 191 279 9.9e-37 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 339 362 N/A INTRINSIC
S_TKc 409 666 2.4e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194452
AA Change: I451V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000141816
Gene: ENSMUSG00000028078
AA Change: I451V

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
Pfam:Pkinase_Tyr 392 590 2.2e-31 PFAM
Pfam:Pkinase 392 591 4.7e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195561
AA Change: I451V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142267
Gene: ENSMUSG00000028078
AA Change: I451V

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 392 649 4.96e-101 SMART
low complexity region 717 739 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmoduline-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. This gene and the DCX gene, another family member, share function in the establishment of hippocampal organization and their absence results in a severe epileptic phenotype and lethality, as described in human patients with lissencephaly. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2010]
Allele List at MGI

All alleles(59) : Targeted, knock-out(1) Gene trapped(58)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,475 H86L possibly damaging Het
2610507B11Rik T A 11: 78,289,343 Y2150N probably damaging Het
4930519G04Rik A G 5: 114,870,217 T31A probably benign Het
Ahcyl1 A G 3: 107,696,189 F30S probably benign Het
Alox5ap G A 5: 149,265,183 probably null Het
Amtn A G 5: 88,378,870 S53G probably null Het
Arap3 A T 18: 37,989,684 probably null Het
Ash1l T A 3: 89,072,476 V2769E probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bhlha9 C T 11: 76,672,631 S28L probably benign Het
Bmpr2 A G 1: 59,868,126 T793A probably benign Het
Ccdc80 G A 16: 45,095,936 A352T probably benign Het
Chst2 A T 9: 95,406,141 F51I probably benign Het
Col14a1 A G 15: 55,380,767 N412S unknown Het
Ddb2 A G 2: 91,234,889 S64P probably benign Het
Diaph1 A G 18: 37,896,093 probably null Het
Dusp4 G T 8: 34,818,416 R277L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Garem1 A T 18: 21,168,874 probably null Het
Gnpat A G 8: 124,870,816 E39G probably damaging Het
Golgb1 A T 16: 36,898,788 Q352L possibly damaging Het
Hdlbp T C 1: 93,417,374 D803G probably benign Het
Hps1 A G 19: 42,759,704 probably null Het
Ilvbl G A 10: 78,579,731 R327H probably benign Het
Itpr3 A G 17: 27,114,147 D1911G possibly damaging Het
Lmo7 T A 14: 101,929,264 probably benign Het
Mcm10 G A 2: 4,998,780 T542I possibly damaging Het
Med1 A G 11: 98,160,946 V497A probably damaging Het
Mn1 G A 5: 111,454,780 A1295T probably damaging Het
Myh7b A C 2: 155,631,787 D1580A probably damaging Het
Naa20 A G 2: 145,912,518 I101V probably benign Het
Nav3 T C 10: 109,866,985 Y229C probably damaging Het
Obscn T C 11: 59,000,749 R6986G unknown Het
Olfr573-ps1 G A 7: 102,942,340 T79I probably damaging Het
Olfr878 A G 9: 37,919,274 I211V probably benign Het
P2rx3 A G 2: 85,023,481 probably null Het
Papd4 C T 13: 93,175,568 G208D probably damaging Het
Pcdhac2 G A 18: 37,146,486 G840R possibly damaging Het
Pclo A G 5: 14,712,475 N3654S unknown Het
Pcnx2 T A 8: 125,877,449 E689D possibly damaging Het
Pds5a A G 5: 65,647,121 S532P probably benign Het
Phf1 G A 17: 26,935,398 probably null Het
Pkp4 G A 2: 59,214,803 V41M probably damaging Het
Prlr T G 15: 10,328,278 probably null Het
Prr12 G T 7: 45,028,942 A1954D unknown Het
Prtg A G 9: 72,809,757 T127A probably benign Het
Ptprh A G 7: 4,549,699 L884P probably damaging Het
Rnf170 T A 8: 26,139,048 D183E probably benign Het
Rrp12 A T 19: 41,886,803 H339Q probably damaging Het
Rubcnl T G 14: 75,040,827 S350R possibly damaging Het
Sgo2b T A 8: 63,926,502 T1099S possibly damaging Het
Ska2 T C 11: 87,116,119 S17P probably damaging Het
Slc38a2 A G 15: 96,693,153 I243T possibly damaging Het
Sptan1 T A 2: 30,026,022 D2007E possibly damaging Het
Taar5 T A 10: 23,970,722 L6H probably benign Het
Tbata G T 10: 61,183,491 probably null Het
Tmem107 T C 11: 69,072,458 S98P probably damaging Het
Tpst2 A G 5: 112,308,420 D275G possibly damaging Het
Ttc28 G T 5: 111,285,318 G2073W probably damaging Het
Ttc7 T C 17: 87,322,463 V291A possibly damaging Het
Vps13b T A 15: 35,792,181 N2198K possibly damaging Het
Wdr37 A T 13: 8,837,003 D249E probably benign Het
Wdr63 T C 3: 146,042,749 E870G probably damaging Het
Xirp2 G T 2: 67,510,013 C866F probably damaging Het
Zfp990 A G 4: 145,536,996 E188G possibly damaging Het
Zkscan2 A G 7: 123,499,841 S43P possibly damaging Het
Zscan5b A G 7: 6,233,851 R200G probably benign Het
Other mutations in Dclk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dclk2 APN 3 86799090 critical splice acceptor site probably null
IGL01769:Dclk2 APN 3 86816360 missense possibly damaging 0.50
IGL01802:Dclk2 APN 3 86799027 missense probably damaging 1.00
IGL02296:Dclk2 APN 3 86793293 missense probably damaging 1.00
IGL02390:Dclk2 APN 3 86824683 missense probably damaging 0.99
IGL02522:Dclk2 APN 3 86920116 missense probably benign 0.01
IGL03104:Dclk2 APN 3 86836359 missense probably damaging 1.00
IGL03337:Dclk2 APN 3 86906059 missense probably damaging 1.00
R0219:Dclk2 UTSW 3 86813669 splice site probably benign
R0400:Dclk2 UTSW 3 86813747 splice site probably null
R0606:Dclk2 UTSW 3 86906004 missense probably damaging 1.00
R1569:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1571:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1612:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1680:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1689:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1714:Dclk2 UTSW 3 86906093 missense probably benign 0.00
R1745:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1746:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1752:Dclk2 UTSW 3 86806127 missense possibly damaging 0.61
R1829:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R2008:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R2125:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R2126:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R2132:Dclk2 UTSW 3 86920046 missense probably benign 0.44
R2314:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R2338:Dclk2 UTSW 3 86799017 missense probably damaging 1.00
R2849:Dclk2 UTSW 3 86793223 missense probably damaging 1.00
R3108:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R3109:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R3615:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R3616:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R4051:Dclk2 UTSW 3 86830822 critical splice donor site probably null
R4052:Dclk2 UTSW 3 86830822 critical splice donor site probably null
R4208:Dclk2 UTSW 3 86830822 critical splice donor site probably null
R4643:Dclk2 UTSW 3 86806180 missense possibly damaging 0.93
R4654:Dclk2 UTSW 3 86836376 missense probably damaging 1.00
R4693:Dclk2 UTSW 3 86815093 missense possibly damaging 0.67
R4716:Dclk2 UTSW 3 86919881 missense probably damaging 1.00
R4914:Dclk2 UTSW 3 86824742 splice site probably null
R4915:Dclk2 UTSW 3 86824742 splice site probably null
R4917:Dclk2 UTSW 3 86824742 splice site probably null
R5218:Dclk2 UTSW 3 86805678 missense probably damaging 1.00
R5510:Dclk2 UTSW 3 86906037 missense possibly damaging 0.93
R5520:Dclk2 UTSW 3 86919840 missense probably damaging 1.00
R5867:Dclk2 UTSW 3 86791859 makesense probably null
R5976:Dclk2 UTSW 3 86787225 missense possibly damaging 0.53
R6048:Dclk2 UTSW 3 86905965 missense probably damaging 1.00
R6111:Dclk2 UTSW 3 86805661 missense probably benign 0.28
R6192:Dclk2 UTSW 3 86815150 missense probably damaging 1.00
R6289:Dclk2 UTSW 3 86831817 missense probably benign 0.18
R6595:Dclk2 UTSW 3 86792067 critical splice donor site probably benign
R6897:Dclk2 UTSW 3 86831763 missense probably benign 0.00
R7061:Dclk2 UTSW 3 86831731 critical splice donor site probably null
R7095:Dclk2 UTSW 3 86793259 missense not run
R7096:Dclk2 UTSW 3 86793259 missense not run
Predicted Primers PCR Primer
(F):5'- ATTTGACACCAGTGAGCCCACC -3'
(R):5'- GTTGTCCTTCCTGTGCTGAGAGAC -3'

Sequencing Primer
(F):5'- GGACACCAGTGAGCCCAC -3'
(R):5'- ACATGTCTCCCTTGGCATCAG -3'
Posted On2014-04-13