Incidental Mutation 'R1537:Ptprh'
ID169593
Institutional Source Beutler Lab
Gene Symbol Ptprh
Ensembl Gene ENSMUSG00000035429
Gene Nameprotein tyrosine phosphatase, receptor type, H
SynonymsSAP-1
MMRRC Submission 039576-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1537 (G1)
Quality Score181
Status Not validated
Chromosome7
Chromosomal Location4548612-4604041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4549699 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 884 (L884P)
Ref Sequence ENSEMBL: ENSMUSP00000145543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049113] [ENSMUST00000065957] [ENSMUST00000166650] [ENSMUST00000206023] [ENSMUST00000206933] [ENSMUST00000206999]
Predicted Effect probably damaging
Transcript: ENSMUST00000049113
AA Change: L884P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042396
Gene: ENSMUSG00000035429
AA Change: L884P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065957
SMART Domains Protein: ENSMUSP00000070322
Gene: ENSMUSG00000004961

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
C2 124 226 2.8e-19 SMART
C2 255 369 4.76e-22 SMART
low complexity region 375 386 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166650
AA Change: L884P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125833
Gene: ENSMUSG00000035429
AA Change: L884P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205417
Predicted Effect probably benign
Transcript: ENSMUST00000206023
Predicted Effect probably benign
Transcript: ENSMUST00000206933
Predicted Effect probably damaging
Transcript: ENSMUST00000206999
AA Change: L884P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. The extracellular region contains eight fibronectin type III-like repeats and multiple N-glycosylation sites. The gene was shown to be expressed primarily in brain and liver, and at a lower level in heart and stomach. It was also found to be expressed in several cancer cell lines, but not in the corresponding normal tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null alllele exhibit normal intestinal epithelial cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,475 H86L possibly damaging Het
2610507B11Rik T A 11: 78,289,343 Y2150N probably damaging Het
4930519G04Rik A G 5: 114,870,217 T31A probably benign Het
Ahcyl1 A G 3: 107,696,189 F30S probably benign Het
Alox5ap G A 5: 149,265,183 probably null Het
Amtn A G 5: 88,378,870 S53G probably null Het
Arap3 A T 18: 37,989,684 probably null Het
Ash1l T A 3: 89,072,476 V2769E probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bhlha9 C T 11: 76,672,631 S28L probably benign Het
Bmpr2 A G 1: 59,868,126 T793A probably benign Het
Ccdc80 G A 16: 45,095,936 A352T probably benign Het
Chst2 A T 9: 95,406,141 F51I probably benign Het
Col14a1 A G 15: 55,380,767 N412S unknown Het
Dclk2 T C 3: 86,806,184 I451V probably damaging Het
Ddb2 A G 2: 91,234,889 S64P probably benign Het
Diaph1 A G 18: 37,896,093 probably null Het
Dusp4 G T 8: 34,818,416 R277L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Garem1 A T 18: 21,168,874 probably null Het
Gnpat A G 8: 124,870,816 E39G probably damaging Het
Golgb1 A T 16: 36,898,788 Q352L possibly damaging Het
Hdlbp T C 1: 93,417,374 D803G probably benign Het
Hps1 A G 19: 42,759,704 probably null Het
Ilvbl G A 10: 78,579,731 R327H probably benign Het
Itpr3 A G 17: 27,114,147 D1911G possibly damaging Het
Lmo7 T A 14: 101,929,264 probably benign Het
Mcm10 G A 2: 4,998,780 T542I possibly damaging Het
Med1 A G 11: 98,160,946 V497A probably damaging Het
Mn1 G A 5: 111,454,780 A1295T probably damaging Het
Myh7b A C 2: 155,631,787 D1580A probably damaging Het
Naa20 A G 2: 145,912,518 I101V probably benign Het
Nav3 T C 10: 109,866,985 Y229C probably damaging Het
Obscn T C 11: 59,000,749 R6986G unknown Het
Olfr573-ps1 G A 7: 102,942,340 T79I probably damaging Het
Olfr878 A G 9: 37,919,274 I211V probably benign Het
P2rx3 A G 2: 85,023,481 probably null Het
Papd4 C T 13: 93,175,568 G208D probably damaging Het
Pcdhac2 G A 18: 37,146,486 G840R possibly damaging Het
Pclo A G 5: 14,712,475 N3654S unknown Het
Pcnx2 T A 8: 125,877,449 E689D possibly damaging Het
Pds5a A G 5: 65,647,121 S532P probably benign Het
Phf1 G A 17: 26,935,398 probably null Het
Pkp4 G A 2: 59,214,803 V41M probably damaging Het
Prlr T G 15: 10,328,278 probably null Het
Prr12 G T 7: 45,028,942 A1954D unknown Het
Prtg A G 9: 72,809,757 T127A probably benign Het
Rnf170 T A 8: 26,139,048 D183E probably benign Het
Rrp12 A T 19: 41,886,803 H339Q probably damaging Het
Rubcnl T G 14: 75,040,827 S350R possibly damaging Het
Sgo2b T A 8: 63,926,502 T1099S possibly damaging Het
Ska2 T C 11: 87,116,119 S17P probably damaging Het
Slc38a2 A G 15: 96,693,153 I243T possibly damaging Het
Sptan1 T A 2: 30,026,022 D2007E possibly damaging Het
Taar5 T A 10: 23,970,722 L6H probably benign Het
Tbata G T 10: 61,183,491 probably null Het
Tmem107 T C 11: 69,072,458 S98P probably damaging Het
Tpst2 A G 5: 112,308,420 D275G possibly damaging Het
Ttc28 G T 5: 111,285,318 G2073W probably damaging Het
Ttc7 T C 17: 87,322,463 V291A possibly damaging Het
Vps13b T A 15: 35,792,181 N2198K possibly damaging Het
Wdr37 A T 13: 8,837,003 D249E probably benign Het
Wdr63 T C 3: 146,042,749 E870G probably damaging Het
Xirp2 G T 2: 67,510,013 C866F probably damaging Het
Zfp990 A G 4: 145,536,996 E188G possibly damaging Het
Zkscan2 A G 7: 123,499,841 S43P possibly damaging Het
Zscan5b A G 7: 6,233,851 R200G probably benign Het
Other mutations in Ptprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Ptprh APN 7 4580916 missense probably benign 0.23
IGL02420:Ptprh APN 7 4580930 missense probably damaging 1.00
IGL02619:Ptprh APN 7 4549499 missense probably damaging 1.00
IGL02729:Ptprh APN 7 4580874 missense probably damaging 0.99
R0018:Ptprh UTSW 7 4601846 critical splice donor site probably null
R0049:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R0449:Ptprh UTSW 7 4598006 missense probably damaging 1.00
R0477:Ptprh UTSW 7 4597998 missense possibly damaging 0.87
R0626:Ptprh UTSW 7 4564272 missense probably benign 0.00
R0741:Ptprh UTSW 7 4554173 critical splice donor site probably null
R1068:Ptprh UTSW 7 4549463 missense possibly damaging 0.89
R1226:Ptprh UTSW 7 4603092 nonsense probably null
R1487:Ptprh UTSW 7 4552738 missense probably damaging 1.00
R1495:Ptprh UTSW 7 4580889 missense probably benign 0.02
R1601:Ptprh UTSW 7 4552638 missense probably damaging 1.00
R1731:Ptprh UTSW 7 4601913 missense probably benign 0.00
R1920:Ptprh UTSW 7 4549395 missense probably benign 0.25
R2082:Ptprh UTSW 7 4550775 missense probably damaging 1.00
R2180:Ptprh UTSW 7 4601868 missense probably benign 0.26
R2214:Ptprh UTSW 7 4552922 missense possibly damaging 0.78
R2245:Ptprh UTSW 7 4573346 missense probably benign 0.09
R2271:Ptprh UTSW 7 4603133 start gained probably benign
R3693:Ptprh UTSW 7 4554235 missense probably damaging 0.99
R3713:Ptprh UTSW 7 4571970 missense probably damaging 1.00
R4081:Ptprh UTSW 7 4580988 missense probably damaging 0.99
R4205:Ptprh UTSW 7 4597992 missense probably damaging 1.00
R4689:Ptprh UTSW 7 4597997 missense possibly damaging 0.74
R4782:Ptprh UTSW 7 4569577 missense probably benign 0.08
R4838:Ptprh UTSW 7 4573430 missense possibly damaging 0.78
R4974:Ptprh UTSW 7 4551007 splice site probably null
R5218:Ptprh UTSW 7 4597920 missense probably benign 0.05
R5430:Ptprh UTSW 7 4551047 missense probably damaging 1.00
R5533:Ptprh UTSW 7 4549505 missense probably damaging 1.00
R5544:Ptprh UTSW 7 4580910 nonsense probably null
R5547:Ptprh UTSW 7 4554222 nonsense probably null
R5869:Ptprh UTSW 7 4601940 missense probably benign 0.00
R5928:Ptprh UTSW 7 4573508 missense probably damaging 1.00
R6063:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R6112:Ptprh UTSW 7 4597923 missense probably benign 0.01
R6493:Ptprh UTSW 7 4580990 missense possibly damaging 0.65
R6733:Ptprh UTSW 7 4603044 splice site probably null
R6836:Ptprh UTSW 7 4551135 missense probably damaging 1.00
R6859:Ptprh UTSW 7 4549371 nonsense probably null
R6868:Ptprh UTSW 7 4601865 missense probably benign
R7015:Ptprh UTSW 7 4552627 critical splice donor site probably null
R7092:Ptprh UTSW 7 4580861 critical splice donor site unknown
R7147:Ptprh UTSW 7 4550782 missense not run
Predicted Primers PCR Primer
(F):5'- AATGAGGGATGCTTCCTGAAGGGC -3'
(R):5'- TCCCCAAACCTGGAGCAAACTGTG -3'

Sequencing Primer
(F):5'- CCCTCAACCCCCACCAC -3'
(R):5'- gttttttgagacaaggtttctctg -3'
Posted On2014-04-13