Incidental Mutation 'R1537:Rnf170'
ID169598
Institutional Source Beutler Lab
Gene Symbol Rnf170
Ensembl Gene ENSMUSG00000013878
Gene Namering finger protein 170
Synonyms6720407G21Rik
MMRRC Submission 039576-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R1537 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location26119368-26151790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26139048 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 183 (D183E)
Ref Sequence ENSEMBL: ENSMUSP00000014022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014022] [ENSMUST00000110579] [ENSMUST00000124757] [ENSMUST00000131138] [ENSMUST00000153528] [ENSMUST00000209300] [ENSMUST00000209707]
Predicted Effect probably benign
Transcript: ENSMUST00000014022
AA Change: D183E

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000014022
Gene: ENSMUSG00000013878
AA Change: D183E

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
RING 115 157 1.06e-8 SMART
Pfam:DUF1232 230 267 4.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110579
SMART Domains Protein: ENSMUSP00000106208
Gene: ENSMUSG00000013878

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
RING 115 138 6.02e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124757
SMART Domains Protein: ENSMUSP00000115588
Gene: ENSMUSG00000013878

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
SCOP:d1fbva4 85 135 1e-6 SMART
Blast:RING 115 136 6e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124867
SMART Domains Protein: ENSMUSP00000115959
Gene: ENSMUSG00000013878

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
SCOP:d1fbva4 49 99 9e-7 SMART
Blast:RING 79 100 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131138
SMART Domains Protein: ENSMUSP00000115452
Gene: ENSMUSG00000109850

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
SCOP:d1fbva4 85 135 1e-6 SMART
Blast:RING 115 135 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153528
AA Change: D136E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000118689
Gene: ENSMUSG00000013878
AA Change: D136E

DomainStartEndE-ValueType
RING 68 110 1.06e-8 SMART
Pfam:DUF1232 181 221 3.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209300
Predicted Effect probably benign
Transcript: ENSMUST00000209707
AA Change: D183E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RING domain-containing protein that resides in the endoplasmic reticulum (ER) membrane. This protein functions as an E3 ubiquitin ligase and mediates ubiquitination and processing of inositol 1,4,5-trisphosphate (IP3) receptors via the ER-associated protein degradation pathway. It is recruited to the activated IP3 receptors by the ERLIN1/ERLIN2 complex to which it is constitutively bound. Mutations in this gene are associated with autosomal dominant sensory ataxia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a null allele develop progressive gait abnormalities that are more pronounced in dark conditions with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,475 H86L possibly damaging Het
2610507B11Rik T A 11: 78,289,343 Y2150N probably damaging Het
4930519G04Rik A G 5: 114,870,217 T31A probably benign Het
Ahcyl1 A G 3: 107,696,189 F30S probably benign Het
Alox5ap G A 5: 149,265,183 probably null Het
Amtn A G 5: 88,378,870 S53G probably null Het
Arap3 A T 18: 37,989,684 probably null Het
Ash1l T A 3: 89,072,476 V2769E probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bhlha9 C T 11: 76,672,631 S28L probably benign Het
Bmpr2 A G 1: 59,868,126 T793A probably benign Het
Ccdc80 G A 16: 45,095,936 A352T probably benign Het
Chst2 A T 9: 95,406,141 F51I probably benign Het
Col14a1 A G 15: 55,380,767 N412S unknown Het
Dclk2 T C 3: 86,806,184 I451V probably damaging Het
Ddb2 A G 2: 91,234,889 S64P probably benign Het
Diaph1 A G 18: 37,896,093 probably null Het
Dusp4 G T 8: 34,818,416 R277L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Garem1 A T 18: 21,168,874 probably null Het
Gnpat A G 8: 124,870,816 E39G probably damaging Het
Golgb1 A T 16: 36,898,788 Q352L possibly damaging Het
Hdlbp T C 1: 93,417,374 D803G probably benign Het
Hps1 A G 19: 42,759,704 probably null Het
Ilvbl G A 10: 78,579,731 R327H probably benign Het
Itpr3 A G 17: 27,114,147 D1911G possibly damaging Het
Lmo7 T A 14: 101,929,264 probably benign Het
Mcm10 G A 2: 4,998,780 T542I possibly damaging Het
Med1 A G 11: 98,160,946 V497A probably damaging Het
Mn1 G A 5: 111,454,780 A1295T probably damaging Het
Myh7b A C 2: 155,631,787 D1580A probably damaging Het
Naa20 A G 2: 145,912,518 I101V probably benign Het
Nav3 T C 10: 109,866,985 Y229C probably damaging Het
Obscn T C 11: 59,000,749 R6986G unknown Het
Olfr573-ps1 G A 7: 102,942,340 T79I probably damaging Het
Olfr878 A G 9: 37,919,274 I211V probably benign Het
P2rx3 A G 2: 85,023,481 probably null Het
Papd4 C T 13: 93,175,568 G208D probably damaging Het
Pcdhac2 G A 18: 37,146,486 G840R possibly damaging Het
Pclo A G 5: 14,712,475 N3654S unknown Het
Pcnx2 T A 8: 125,877,449 E689D possibly damaging Het
Pds5a A G 5: 65,647,121 S532P probably benign Het
Phf1 G A 17: 26,935,398 probably null Het
Pkp4 G A 2: 59,214,803 V41M probably damaging Het
Prlr T G 15: 10,328,278 probably null Het
Prr12 G T 7: 45,028,942 A1954D unknown Het
Prtg A G 9: 72,809,757 T127A probably benign Het
Ptprh A G 7: 4,549,699 L884P probably damaging Het
Rrp12 A T 19: 41,886,803 H339Q probably damaging Het
Rubcnl T G 14: 75,040,827 S350R possibly damaging Het
Sgo2b T A 8: 63,926,502 T1099S possibly damaging Het
Ska2 T C 11: 87,116,119 S17P probably damaging Het
Slc38a2 A G 15: 96,693,153 I243T possibly damaging Het
Sptan1 T A 2: 30,026,022 D2007E possibly damaging Het
Taar5 T A 10: 23,970,722 L6H probably benign Het
Tbata G T 10: 61,183,491 probably null Het
Tmem107 T C 11: 69,072,458 S98P probably damaging Het
Tpst2 A G 5: 112,308,420 D275G possibly damaging Het
Ttc28 G T 5: 111,285,318 G2073W probably damaging Het
Ttc7 T C 17: 87,322,463 V291A possibly damaging Het
Vps13b T A 15: 35,792,181 N2198K possibly damaging Het
Wdr37 A T 13: 8,837,003 D249E probably benign Het
Wdr63 T C 3: 146,042,749 E870G probably damaging Het
Xirp2 G T 2: 67,510,013 C866F probably damaging Het
Zfp990 A G 4: 145,536,996 E188G possibly damaging Het
Zkscan2 A G 7: 123,499,841 S43P possibly damaging Het
Zscan5b A G 7: 6,233,851 R200G probably benign Het
Other mutations in Rnf170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Rnf170 APN 8 26125918 missense probably damaging 1.00
IGL02100:Rnf170 APN 8 26123984 missense probably damaging 1.00
R0382:Rnf170 UTSW 8 26125899 splice site probably benign
R1663:Rnf170 UTSW 8 26129143 missense probably damaging 1.00
R4788:Rnf170 UTSW 8 26140863 missense probably damaging 0.98
R4940:Rnf170 UTSW 8 26125911 nonsense probably null
R5174:Rnf170 UTSW 8 26129168 missense probably benign 0.22
R5511:Rnf170 UTSW 8 26140999 missense probably damaging 1.00
R6115:Rnf170 UTSW 8 26125966 missense possibly damaging 0.57
R6291:Rnf170 UTSW 8 26140964 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCAGTCGGGAGTGCCTAAATC -3'
(R):5'- CTGCCCTCTGGGAAAACTAGCAAC -3'

Sequencing Primer
(F):5'- TGTAAGGCAGAAATTACTCACACG -3'
(R):5'- AACTAGCAACTGGCAATGATG -3'
Posted On2014-04-13