Incidental Mutation 'R1537:Gnpat'
ID169603
Institutional Source Beutler Lab
Gene Symbol Gnpat
Ensembl Gene ENSMUSG00000031985
Gene Nameglyceronephosphate O-acyltransferase
SynonymsD1Ertd819e
MMRRC Submission 039576-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R1537 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location124863033-124890057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124870816 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 39 (E39G)
Ref Sequence ENSEMBL: ENSMUSP00000125323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034466] [ENSMUST00000161986]
Predicted Effect probably damaging
Transcript: ENSMUST00000034466
AA Change: E39G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034466
Gene: ENSMUSG00000031985
AA Change: E39G

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
SCOP:d1dbha1 27 146 6e-3 SMART
PlsC 155 284 8.3e-21 SMART
Blast:PlsC 308 336 1e-6 BLAST
low complexity region 638 652 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161986
AA Change: E39G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125323
Gene: ENSMUSG00000031985
AA Change: E39G

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
PlsC 145 274 8.3e-21 SMART
Blast:PlsC 298 326 2e-6 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme located in the peroxisomal membrane which is essential to the synthesis of ether phospholipids. Mutations in this gene are associated with rhizomelic chondrodysplasia punctata. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice lack plasmalogens due to inactivation of ether lipid synthesis. Mutant mice exhibit dwarfism, male infertility, defects in eye development, and optic nerve hypoplasia. While some mice die prematurely, others, particularly females, are long-lived. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,475 H86L possibly damaging Het
2610507B11Rik T A 11: 78,289,343 Y2150N probably damaging Het
4930519G04Rik A G 5: 114,870,217 T31A probably benign Het
Ahcyl1 A G 3: 107,696,189 F30S probably benign Het
Alox5ap G A 5: 149,265,183 probably null Het
Amtn A G 5: 88,378,870 S53G probably null Het
Arap3 A T 18: 37,989,684 probably null Het
Ash1l T A 3: 89,072,476 V2769E probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bhlha9 C T 11: 76,672,631 S28L probably benign Het
Bmpr2 A G 1: 59,868,126 T793A probably benign Het
Ccdc80 G A 16: 45,095,936 A352T probably benign Het
Chst2 A T 9: 95,406,141 F51I probably benign Het
Col14a1 A G 15: 55,380,767 N412S unknown Het
Dclk2 T C 3: 86,806,184 I451V probably damaging Het
Ddb2 A G 2: 91,234,889 S64P probably benign Het
Diaph1 A G 18: 37,896,093 probably null Het
Dusp4 G T 8: 34,818,416 R277L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Garem1 A T 18: 21,168,874 probably null Het
Golgb1 A T 16: 36,898,788 Q352L possibly damaging Het
Hdlbp T C 1: 93,417,374 D803G probably benign Het
Hps1 A G 19: 42,759,704 probably null Het
Ilvbl G A 10: 78,579,731 R327H probably benign Het
Itpr3 A G 17: 27,114,147 D1911G possibly damaging Het
Lmo7 T A 14: 101,929,264 probably benign Het
Mcm10 G A 2: 4,998,780 T542I possibly damaging Het
Med1 A G 11: 98,160,946 V497A probably damaging Het
Mn1 G A 5: 111,454,780 A1295T probably damaging Het
Myh7b A C 2: 155,631,787 D1580A probably damaging Het
Naa20 A G 2: 145,912,518 I101V probably benign Het
Nav3 T C 10: 109,866,985 Y229C probably damaging Het
Obscn T C 11: 59,000,749 R6986G unknown Het
Olfr573-ps1 G A 7: 102,942,340 T79I probably damaging Het
Olfr878 A G 9: 37,919,274 I211V probably benign Het
P2rx3 A G 2: 85,023,481 probably null Het
Papd4 C T 13: 93,175,568 G208D probably damaging Het
Pcdhac2 G A 18: 37,146,486 G840R possibly damaging Het
Pclo A G 5: 14,712,475 N3654S unknown Het
Pcnx2 T A 8: 125,877,449 E689D possibly damaging Het
Pds5a A G 5: 65,647,121 S532P probably benign Het
Phf1 G A 17: 26,935,398 probably null Het
Pkp4 G A 2: 59,214,803 V41M probably damaging Het
Prlr T G 15: 10,328,278 probably null Het
Prr12 G T 7: 45,028,942 A1954D unknown Het
Prtg A G 9: 72,809,757 T127A probably benign Het
Ptprh A G 7: 4,549,699 L884P probably damaging Het
Rnf170 T A 8: 26,139,048 D183E probably benign Het
Rrp12 A T 19: 41,886,803 H339Q probably damaging Het
Rubcnl T G 14: 75,040,827 S350R possibly damaging Het
Sgo2b T A 8: 63,926,502 T1099S possibly damaging Het
Ska2 T C 11: 87,116,119 S17P probably damaging Het
Slc38a2 A G 15: 96,693,153 I243T possibly damaging Het
Sptan1 T A 2: 30,026,022 D2007E possibly damaging Het
Taar5 T A 10: 23,970,722 L6H probably benign Het
Tbata G T 10: 61,183,491 probably null Het
Tmem107 T C 11: 69,072,458 S98P probably damaging Het
Tpst2 A G 5: 112,308,420 D275G possibly damaging Het
Ttc28 G T 5: 111,285,318 G2073W probably damaging Het
Ttc7 T C 17: 87,322,463 V291A possibly damaging Het
Vps13b T A 15: 35,792,181 N2198K possibly damaging Het
Wdr37 A T 13: 8,837,003 D249E probably benign Het
Wdr63 T C 3: 146,042,749 E870G probably damaging Het
Xirp2 G T 2: 67,510,013 C866F probably damaging Het
Zfp990 A G 4: 145,536,996 E188G possibly damaging Het
Zkscan2 A G 7: 123,499,841 S43P possibly damaging Het
Zscan5b A G 7: 6,233,851 R200G probably benign Het
Other mutations in Gnpat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Gnpat APN 8 124876914 splice site probably benign
IGL00422:Gnpat APN 8 124885013 missense probably damaging 1.00
IGL01327:Gnpat APN 8 124878633 missense probably damaging 1.00
IGL02257:Gnpat APN 8 124886848 unclassified probably benign
IGL02951:Gnpat APN 8 124870905 missense probably benign 0.01
IGL03084:Gnpat APN 8 124878899 missense probably damaging 0.99
R0114:Gnpat UTSW 8 124883357 missense probably benign 0.06
R0394:Gnpat UTSW 8 124880225 missense possibly damaging 0.82
R1023:Gnpat UTSW 8 124870780 missense probably benign 0.28
R1052:Gnpat UTSW 8 124877507 missense probably benign 0.00
R1052:Gnpat UTSW 8 124878516 missense probably damaging 1.00
R1604:Gnpat UTSW 8 124876961 missense probably damaging 1.00
R1711:Gnpat UTSW 8 124886952 splice site probably null
R1754:Gnpat UTSW 8 124877006 missense probably damaging 1.00
R2118:Gnpat UTSW 8 124876941 missense probably damaging 0.99
R2278:Gnpat UTSW 8 124876920 missense probably benign 0.35
R2429:Gnpat UTSW 8 124877019 missense probably damaging 1.00
R4579:Gnpat UTSW 8 124878502 splice site probably null
R6176:Gnpat UTSW 8 124878854 missense probably damaging 1.00
R7017:Gnpat UTSW 8 124863275 missense probably benign 0.33
R7081:Gnpat UTSW 8 124863269 missense not run
X0025:Gnpat UTSW 8 124873399 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- CCTTTGTCTGAGCCTAGCATTAGAACAC -3'
(R):5'- TTTCATAACATACCATGCATTTGGCACC -3'

Sequencing Primer
(F):5'- GAGCCTAGCATTAGAACACTTGTAG -3'
(R):5'- GTGCCATGCAGCTAAACTTG -3'
Posted On2014-04-13