Incidental Mutation 'R1537:Olfr878'
ID169605
Institutional Source Beutler Lab
Gene Symbol Olfr878
Ensembl Gene ENSMUSG00000066747
Gene Nameolfactory receptor 878
SynonymsMOR163-1, GA_x6K02T2PVTD-31600511-31601440
MMRRC Submission 039576-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R1537 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location37917840-37922474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37919274 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 211 (I211V)
Ref Sequence ENSEMBL: ENSMUSP00000083228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086061] [ENSMUST00000212878] [ENSMUST00000214263] [ENSMUST00000216723]
Predicted Effect probably benign
Transcript: ENSMUST00000086061
AA Change: I211V

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000083228
Gene: ENSMUSG00000066747
AA Change: I211V

DomainStartEndE-ValueType
Pfam:7tm_4 36 312 1.4e-46 PFAM
Pfam:7tm_1 46 294 5.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212878
AA Change: I206V

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000214263
AA Change: I206V

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214813
Predicted Effect probably benign
Transcript: ENSMUST00000216723
AA Change: I206V

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,475 H86L possibly damaging Het
2610507B11Rik T A 11: 78,289,343 Y2150N probably damaging Het
4930519G04Rik A G 5: 114,870,217 T31A probably benign Het
Ahcyl1 A G 3: 107,696,189 F30S probably benign Het
Alox5ap G A 5: 149,265,183 probably null Het
Amtn A G 5: 88,378,870 S53G probably null Het
Arap3 A T 18: 37,989,684 probably null Het
Ash1l T A 3: 89,072,476 V2769E probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bhlha9 C T 11: 76,672,631 S28L probably benign Het
Bmpr2 A G 1: 59,868,126 T793A probably benign Het
Ccdc80 G A 16: 45,095,936 A352T probably benign Het
Chst2 A T 9: 95,406,141 F51I probably benign Het
Col14a1 A G 15: 55,380,767 N412S unknown Het
Dclk2 T C 3: 86,806,184 I451V probably damaging Het
Ddb2 A G 2: 91,234,889 S64P probably benign Het
Diaph1 A G 18: 37,896,093 probably null Het
Dusp4 G T 8: 34,818,416 R277L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Garem1 A T 18: 21,168,874 probably null Het
Gnpat A G 8: 124,870,816 E39G probably damaging Het
Golgb1 A T 16: 36,898,788 Q352L possibly damaging Het
Hdlbp T C 1: 93,417,374 D803G probably benign Het
Hps1 A G 19: 42,759,704 probably null Het
Ilvbl G A 10: 78,579,731 R327H probably benign Het
Itpr3 A G 17: 27,114,147 D1911G possibly damaging Het
Lmo7 T A 14: 101,929,264 probably benign Het
Mcm10 G A 2: 4,998,780 T542I possibly damaging Het
Med1 A G 11: 98,160,946 V497A probably damaging Het
Mn1 G A 5: 111,454,780 A1295T probably damaging Het
Myh7b A C 2: 155,631,787 D1580A probably damaging Het
Naa20 A G 2: 145,912,518 I101V probably benign Het
Nav3 T C 10: 109,866,985 Y229C probably damaging Het
Obscn T C 11: 59,000,749 R6986G unknown Het
Olfr573-ps1 G A 7: 102,942,340 T79I probably damaging Het
P2rx3 A G 2: 85,023,481 probably null Het
Papd4 C T 13: 93,175,568 G208D probably damaging Het
Pcdhac2 G A 18: 37,146,486 G840R possibly damaging Het
Pclo A G 5: 14,712,475 N3654S unknown Het
Pcnx2 T A 8: 125,877,449 E689D possibly damaging Het
Pds5a A G 5: 65,647,121 S532P probably benign Het
Phf1 G A 17: 26,935,398 probably null Het
Pkp4 G A 2: 59,214,803 V41M probably damaging Het
Prlr T G 15: 10,328,278 probably null Het
Prr12 G T 7: 45,028,942 A1954D unknown Het
Prtg A G 9: 72,809,757 T127A probably benign Het
Ptprh A G 7: 4,549,699 L884P probably damaging Het
Rnf170 T A 8: 26,139,048 D183E probably benign Het
Rrp12 A T 19: 41,886,803 H339Q probably damaging Het
Rubcnl T G 14: 75,040,827 S350R possibly damaging Het
Sgo2b T A 8: 63,926,502 T1099S possibly damaging Het
Ska2 T C 11: 87,116,119 S17P probably damaging Het
Slc38a2 A G 15: 96,693,153 I243T possibly damaging Het
Sptan1 T A 2: 30,026,022 D2007E possibly damaging Het
Taar5 T A 10: 23,970,722 L6H probably benign Het
Tbata G T 10: 61,183,491 probably null Het
Tmem107 T C 11: 69,072,458 S98P probably damaging Het
Tpst2 A G 5: 112,308,420 D275G possibly damaging Het
Ttc28 G T 5: 111,285,318 G2073W probably damaging Het
Ttc7 T C 17: 87,322,463 V291A possibly damaging Het
Vps13b T A 15: 35,792,181 N2198K possibly damaging Het
Wdr37 A T 13: 8,837,003 D249E probably benign Het
Wdr63 T C 3: 146,042,749 E870G probably damaging Het
Xirp2 G T 2: 67,510,013 C866F probably damaging Het
Zfp990 A G 4: 145,536,996 E188G possibly damaging Het
Zkscan2 A G 7: 123,499,841 S43P possibly damaging Het
Zscan5b A G 7: 6,233,851 R200G probably benign Het
Other mutations in Olfr878
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Olfr878 APN 9 37919050 missense probably damaging 1.00
IGL01354:Olfr878 APN 9 37919544 missense possibly damaging 0.74
R0399:Olfr878 UTSW 9 37919553 missense possibly damaging 0.85
R3737:Olfr878 UTSW 9 37918641 splice site probably benign
R4035:Olfr878 UTSW 9 37918641 splice site probably benign
R4675:Olfr878 UTSW 9 37919586 makesense probably null
R4700:Olfr878 UTSW 9 37918921 missense possibly damaging 0.77
R5719:Olfr878 UTSW 9 37919351 missense probably damaging 1.00
R5824:Olfr878 UTSW 9 37919565 missense probably benign 0.00
R5940:Olfr878 UTSW 9 37919437 missense probably damaging 1.00
R6116:Olfr878 UTSW 9 37918659 start codon destroyed probably null 0.94
R6705:Olfr878 UTSW 9 37918784 missense probably damaging 1.00
R7075:Olfr878 UTSW 9 37919074 missense not run
Predicted Primers PCR Primer
(F):5'- GCAATCCTCTGCTGTACACAGTTACC -3'
(R):5'- CCCTCTTCCATTGAACCAGGGAAAG -3'

Sequencing Primer
(F):5'- TGCTGTACACAGTTACCATGTC -3'
(R):5'- GAGGTTGTTAAATAGGTGAATGCCC -3'
Posted On2014-04-13