Incidental Mutation 'R1537:Ilvbl'
ID169609
Institutional Source Beutler Lab
Gene Symbol Ilvbl
Ensembl Gene ENSMUSG00000032763
Gene NameilvB (bacterial acetolactate synthase)-like
Synonyms
MMRRC Submission 039576-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R1537 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location78574346-78584502 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78579731 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 327 (R327H)
Ref Sequence ENSEMBL: ENSMUSP00000151521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040580] [ENSMUST00000105384] [ENSMUST00000218061] [ENSMUST00000218215] [ENSMUST00000218271] [ENSMUST00000218763] [ENSMUST00000218787] [ENSMUST00000218875] [ENSMUST00000218885] [ENSMUST00000220430]
Predicted Effect probably benign
Transcript: ENSMUST00000040580
SMART Domains Protein: ENSMUSP00000043085
Gene: ENSMUSG00000032714

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 56 69 N/A INTRINSIC
low complexity region 114 127 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 321 335 N/A INTRINSIC
RhoGAP 411 601 1.49e-56 SMART
low complexity region 638 652 N/A INTRINSIC
low complexity region 681 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105384
AA Change: R327H

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101023
Gene: ENSMUSG00000032763
AA Change: R327H

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:TPP_enzyme_N 52 220 1.4e-53 PFAM
Pfam:TPP_enzyme_M 273 405 2.1e-16 PFAM
Pfam:TPP_enzyme_C 467 618 3.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218061
Predicted Effect probably benign
Transcript: ENSMUST00000218215
AA Change: R327H

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000218271
AA Change: R327H

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218670
Predicted Effect probably benign
Transcript: ENSMUST00000218763
Predicted Effect probably benign
Transcript: ENSMUST00000218787
Predicted Effect probably benign
Transcript: ENSMUST00000218875
AA Change: R327H

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000218885
AA Change: R327H

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect unknown
Transcript: ENSMUST00000219588
AA Change: R198H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219971
Predicted Effect probably benign
Transcript: ENSMUST00000220430
AA Change: R327H

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with several thiamine pyrophosphate-binding proteins identified in bacteria, yeast, and plants. The highest degree of similarity is found with bacterial acetolactate synthases (AHAS), which are enzymes that catalyze the first step in branched-chain amino acid biosynthesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,475 H86L possibly damaging Het
2610507B11Rik T A 11: 78,289,343 Y2150N probably damaging Het
4930519G04Rik A G 5: 114,870,217 T31A probably benign Het
Ahcyl1 A G 3: 107,696,189 F30S probably benign Het
Alox5ap G A 5: 149,265,183 probably null Het
Amtn A G 5: 88,378,870 S53G probably null Het
Arap3 A T 18: 37,989,684 probably null Het
Ash1l T A 3: 89,072,476 V2769E probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bhlha9 C T 11: 76,672,631 S28L probably benign Het
Bmpr2 A G 1: 59,868,126 T793A probably benign Het
Ccdc80 G A 16: 45,095,936 A352T probably benign Het
Chst2 A T 9: 95,406,141 F51I probably benign Het
Col14a1 A G 15: 55,380,767 N412S unknown Het
Dclk2 T C 3: 86,806,184 I451V probably damaging Het
Ddb2 A G 2: 91,234,889 S64P probably benign Het
Diaph1 A G 18: 37,896,093 probably null Het
Dusp4 G T 8: 34,818,416 R277L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Garem1 A T 18: 21,168,874 probably null Het
Gnpat A G 8: 124,870,816 E39G probably damaging Het
Golgb1 A T 16: 36,898,788 Q352L possibly damaging Het
Hdlbp T C 1: 93,417,374 D803G probably benign Het
Hps1 A G 19: 42,759,704 probably null Het
Itpr3 A G 17: 27,114,147 D1911G possibly damaging Het
Lmo7 T A 14: 101,929,264 probably benign Het
Mcm10 G A 2: 4,998,780 T542I possibly damaging Het
Med1 A G 11: 98,160,946 V497A probably damaging Het
Mn1 G A 5: 111,454,780 A1295T probably damaging Het
Myh7b A C 2: 155,631,787 D1580A probably damaging Het
Naa20 A G 2: 145,912,518 I101V probably benign Het
Nav3 T C 10: 109,866,985 Y229C probably damaging Het
Obscn T C 11: 59,000,749 R6986G unknown Het
Olfr573-ps1 G A 7: 102,942,340 T79I probably damaging Het
Olfr878 A G 9: 37,919,274 I211V probably benign Het
P2rx3 A G 2: 85,023,481 probably null Het
Papd4 C T 13: 93,175,568 G208D probably damaging Het
Pcdhac2 G A 18: 37,146,486 G840R possibly damaging Het
Pclo A G 5: 14,712,475 N3654S unknown Het
Pcnx2 T A 8: 125,877,449 E689D possibly damaging Het
Pds5a A G 5: 65,647,121 S532P probably benign Het
Phf1 G A 17: 26,935,398 probably null Het
Pkp4 G A 2: 59,214,803 V41M probably damaging Het
Prlr T G 15: 10,328,278 probably null Het
Prr12 G T 7: 45,028,942 A1954D unknown Het
Prtg A G 9: 72,809,757 T127A probably benign Het
Ptprh A G 7: 4,549,699 L884P probably damaging Het
Rnf170 T A 8: 26,139,048 D183E probably benign Het
Rrp12 A T 19: 41,886,803 H339Q probably damaging Het
Rubcnl T G 14: 75,040,827 S350R possibly damaging Het
Sgo2b T A 8: 63,926,502 T1099S possibly damaging Het
Ska2 T C 11: 87,116,119 S17P probably damaging Het
Slc38a2 A G 15: 96,693,153 I243T possibly damaging Het
Sptan1 T A 2: 30,026,022 D2007E possibly damaging Het
Taar5 T A 10: 23,970,722 L6H probably benign Het
Tbata G T 10: 61,183,491 probably null Het
Tmem107 T C 11: 69,072,458 S98P probably damaging Het
Tpst2 A G 5: 112,308,420 D275G possibly damaging Het
Ttc28 G T 5: 111,285,318 G2073W probably damaging Het
Ttc7 T C 17: 87,322,463 V291A possibly damaging Het
Vps13b T A 15: 35,792,181 N2198K possibly damaging Het
Wdr37 A T 13: 8,837,003 D249E probably benign Het
Wdr63 T C 3: 146,042,749 E870G probably damaging Het
Xirp2 G T 2: 67,510,013 C866F probably damaging Het
Zfp990 A G 4: 145,536,996 E188G possibly damaging Het
Zkscan2 A G 7: 123,499,841 S43P possibly damaging Het
Zscan5b A G 7: 6,233,851 R200G probably benign Het
Other mutations in Ilvbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Ilvbl APN 10 78583905 missense probably damaging 1.00
IGL00962:Ilvbl APN 10 78583338 missense possibly damaging 0.95
IGL01655:Ilvbl APN 10 78577333 splice site probably benign
IGL01657:Ilvbl APN 10 78576768 missense possibly damaging 0.57
IGL01682:Ilvbl APN 10 78577107 splice site probably benign
IGL01768:Ilvbl APN 10 78583293 missense possibly damaging 0.80
IGL01982:Ilvbl APN 10 78579022 missense probably damaging 1.00
IGL02207:Ilvbl APN 10 78583702 critical splice donor site probably null
IGL02561:Ilvbl APN 10 78577144 missense probably benign 0.01
IGL02985:Ilvbl APN 10 78579067 missense probably benign 0.00
R0398:Ilvbl UTSW 10 78579539 missense probably damaging 0.99
R0557:Ilvbl UTSW 10 78583487 nonsense probably null
R0562:Ilvbl UTSW 10 78583487 missense probably damaging 1.00
R0583:Ilvbl UTSW 10 78583267 missense probably damaging 0.99
R1381:Ilvbl UTSW 10 78576596 missense probably damaging 1.00
R1484:Ilvbl UTSW 10 78576730 missense probably damaging 1.00
R1862:Ilvbl UTSW 10 78584124 missense probably benign 0.00
R2474:Ilvbl UTSW 10 78576724 missense probably damaging 1.00
R2876:Ilvbl UTSW 10 78583056 missense probably benign
R3621:Ilvbl UTSW 10 78577180 missense probably damaging 1.00
R3811:Ilvbl UTSW 10 78579035 missense probably benign
R4591:Ilvbl UTSW 10 78583305 missense probably benign 0.01
R5040:Ilvbl UTSW 10 78583318 missense probably damaging 1.00
R5449:Ilvbl UTSW 10 78577028 critical splice donor site probably null
R5795:Ilvbl UTSW 10 78577144 missense probably benign 0.01
R5910:Ilvbl UTSW 10 78577113 missense probably benign
R6746:Ilvbl UTSW 10 78577223 missense possibly damaging 0.48
R7019:Ilvbl UTSW 10 78579086 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTACTTATCACTCCAGGTCCAGCG -3'
(R):5'- AGCAAGTGCCCACAGGGTTTAC -3'

Sequencing Primer
(F):5'- CTGTGTGGAGATCCTGAGCC -3'
(R):5'- GCTCAGTGGCCTTTAGAAGAG -3'
Posted On2014-04-13