Incidental Mutation 'R1537:Col14a1'
ID169624
Institutional Source Beutler Lab
Gene Symbol Col14a1
Ensembl Gene ENSMUSG00000022371
Gene Namecollagen, type XIV, alpha 1
Synonyms5730412L22Rik
MMRRC Submission 039576-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1537 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location55307750-55520803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55380767 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 412 (N412S)
Ref Sequence ENSEMBL: ENSMUSP00000105850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023053] [ENSMUST00000110217] [ENSMUST00000110221]
Predicted Effect unknown
Transcript: ENSMUST00000023053
AA Change: N412S
SMART Domains Protein: ENSMUSP00000023053
Gene: ENSMUSG00000022371
AA Change: N412S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 818 6.2e-7 SMART
FN3 830 909 1.45e-7 SMART
FN3 920 999 3.59e0 SMART
low complexity region 1010 1022 N/A INTRINSIC
VWA 1031 1211 2.02e-59 SMART
TSPN 1230 1425 1.19e-66 SMART
Pfam:Collagen 1461 1515 2.9e-8 PFAM
Pfam:Collagen 1513 1571 6.3e-9 PFAM
Pfam:Collagen 1555 1615 8.5e-10 PFAM
Pfam:Collagen 1653 1709 7.6e-10 PFAM
Pfam:Collagen 1707 1762 2.6e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110217
AA Change: N412S
SMART Domains Protein: ENSMUSP00000105846
Gene: ENSMUSG00000022371
AA Change: N412S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 819 5.4e-7 SMART
FN3 831 910 1.45e-7 SMART
FN3 921 1000 3.59e0 SMART
low complexity region 1011 1023 N/A INTRINSIC
VWA 1032 1212 2.02e-59 SMART
TSPN 1231 1426 1.19e-66 SMART
Pfam:Collagen 1462 1516 2.5e-8 PFAM
Pfam:Collagen 1514 1572 5.4e-9 PFAM
Pfam:Collagen 1556 1616 7.3e-10 PFAM
Pfam:Collagen 1654 1710 6.5e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110221
AA Change: N412S
SMART Domains Protein: ENSMUSP00000105850
Gene: ENSMUSG00000022371
AA Change: N412S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 815 7.12e-7 SMART
FN3 827 906 1.45e-7 SMART
FN3 917 996 3.59e0 SMART
low complexity region 1007 1019 N/A INTRINSIC
VWA 1028 1208 2.02e-59 SMART
TSPN 1227 1422 1.19e-66 SMART
Pfam:Collagen 1458 1512 8.2e-9 PFAM
Pfam:Collagen 1510 1568 1.8e-9 PFAM
Pfam:Collagen 1552 1612 2.4e-10 PFAM
Pfam:Collagen 1650 1706 2.2e-10 PFAM
Pfam:Collagen 1704 1759 7.5e-8 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIV collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XIV collagen interacts with the fibril surface and is involved in the regulation of fibrillogenesis. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null mutation display abnormal tendon morphology and abnormal biomechanical properties of the skin and tendons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,475 H86L possibly damaging Het
2610507B11Rik T A 11: 78,289,343 Y2150N probably damaging Het
4930519G04Rik A G 5: 114,870,217 T31A probably benign Het
Ahcyl1 A G 3: 107,696,189 F30S probably benign Het
Alox5ap G A 5: 149,265,183 probably null Het
Amtn A G 5: 88,378,870 S53G probably null Het
Arap3 A T 18: 37,989,684 probably null Het
Ash1l T A 3: 89,072,476 V2769E probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bhlha9 C T 11: 76,672,631 S28L probably benign Het
Bmpr2 A G 1: 59,868,126 T793A probably benign Het
Ccdc80 G A 16: 45,095,936 A352T probably benign Het
Chst2 A T 9: 95,406,141 F51I probably benign Het
Dclk2 T C 3: 86,806,184 I451V probably damaging Het
Ddb2 A G 2: 91,234,889 S64P probably benign Het
Diaph1 A G 18: 37,896,093 probably null Het
Dusp4 G T 8: 34,818,416 R277L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Garem1 A T 18: 21,168,874 probably null Het
Gnpat A G 8: 124,870,816 E39G probably damaging Het
Golgb1 A T 16: 36,898,788 Q352L possibly damaging Het
Hdlbp T C 1: 93,417,374 D803G probably benign Het
Hps1 A G 19: 42,759,704 probably null Het
Ilvbl G A 10: 78,579,731 R327H probably benign Het
Itpr3 A G 17: 27,114,147 D1911G possibly damaging Het
Lmo7 T A 14: 101,929,264 probably benign Het
Mcm10 G A 2: 4,998,780 T542I possibly damaging Het
Med1 A G 11: 98,160,946 V497A probably damaging Het
Mn1 G A 5: 111,454,780 A1295T probably damaging Het
Myh7b A C 2: 155,631,787 D1580A probably damaging Het
Naa20 A G 2: 145,912,518 I101V probably benign Het
Nav3 T C 10: 109,866,985 Y229C probably damaging Het
Obscn T C 11: 59,000,749 R6986G unknown Het
Olfr573-ps1 G A 7: 102,942,340 T79I probably damaging Het
Olfr878 A G 9: 37,919,274 I211V probably benign Het
P2rx3 A G 2: 85,023,481 probably null Het
Papd4 C T 13: 93,175,568 G208D probably damaging Het
Pcdhac2 G A 18: 37,146,486 G840R possibly damaging Het
Pclo A G 5: 14,712,475 N3654S unknown Het
Pcnx2 T A 8: 125,877,449 E689D possibly damaging Het
Pds5a A G 5: 65,647,121 S532P probably benign Het
Phf1 G A 17: 26,935,398 probably null Het
Pkp4 G A 2: 59,214,803 V41M probably damaging Het
Prlr T G 15: 10,328,278 probably null Het
Prr12 G T 7: 45,028,942 A1954D unknown Het
Prtg A G 9: 72,809,757 T127A probably benign Het
Ptprh A G 7: 4,549,699 L884P probably damaging Het
Rnf170 T A 8: 26,139,048 D183E probably benign Het
Rrp12 A T 19: 41,886,803 H339Q probably damaging Het
Rubcnl T G 14: 75,040,827 S350R possibly damaging Het
Sgo2b T A 8: 63,926,502 T1099S possibly damaging Het
Ska2 T C 11: 87,116,119 S17P probably damaging Het
Slc38a2 A G 15: 96,693,153 I243T possibly damaging Het
Sptan1 T A 2: 30,026,022 D2007E possibly damaging Het
Taar5 T A 10: 23,970,722 L6H probably benign Het
Tbata G T 10: 61,183,491 probably null Het
Tmem107 T C 11: 69,072,458 S98P probably damaging Het
Tpst2 A G 5: 112,308,420 D275G possibly damaging Het
Ttc28 G T 5: 111,285,318 G2073W probably damaging Het
Ttc7 T C 17: 87,322,463 V291A possibly damaging Het
Vps13b T A 15: 35,792,181 N2198K possibly damaging Het
Wdr37 A T 13: 8,837,003 D249E probably benign Het
Wdr63 T C 3: 146,042,749 E870G probably damaging Het
Xirp2 G T 2: 67,510,013 C866F probably damaging Het
Zfp990 A G 4: 145,536,996 E188G possibly damaging Het
Zkscan2 A G 7: 123,499,841 S43P possibly damaging Het
Zscan5b A G 7: 6,233,851 R200G probably benign Het
Other mutations in Col14a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Col14a1 APN 15 55411585 missense unknown
IGL01290:Col14a1 APN 15 55423507 missense unknown
IGL01300:Col14a1 APN 15 55467976 missense unknown
IGL01505:Col14a1 APN 15 55455223 missense unknown
IGL01533:Col14a1 APN 15 55420840 missense unknown
IGL01563:Col14a1 APN 15 55487941 missense unknown
IGL01650:Col14a1 APN 15 55406693 missense unknown
IGL01659:Col14a1 APN 15 55446172 unclassified probably benign
IGL01670:Col14a1 APN 15 55329266 missense unknown
IGL01760:Col14a1 APN 15 55423459 missense unknown
IGL01803:Col14a1 APN 15 55418814 missense unknown
IGL01966:Col14a1 APN 15 55448725 unclassified probably benign
IGL01990:Col14a1 APN 15 55363463 missense unknown
IGL02124:Col14a1 APN 15 55463703 missense unknown
IGL02138:Col14a1 APN 15 55420835 missense unknown
IGL02192:Col14a1 APN 15 55362402 missense unknown
IGL02326:Col14a1 APN 15 55418797 missense unknown
IGL02335:Col14a1 APN 15 55463769 splice site probably benign
IGL02407:Col14a1 APN 15 55448876 splice site probably benign
IGL02486:Col14a1 APN 15 55388696 splice site probably benign
IGL02537:Col14a1 APN 15 55344914 nonsense probably null
IGL02567:Col14a1 APN 15 55344961 critical splice donor site probably null
IGL02643:Col14a1 APN 15 55420862 missense unknown
IGL02669:Col14a1 APN 15 55418782 missense unknown
IGL02673:Col14a1 APN 15 55418782 missense unknown
IGL02674:Col14a1 APN 15 55418782 missense unknown
IGL03201:Col14a1 APN 15 55408904 missense unknown
IGL03334:Col14a1 APN 15 55448821 unclassified probably benign
IGL03370:Col14a1 APN 15 55488541 splice site probably null
IGL03385:Col14a1 APN 15 55410204 missense unknown
IGL03385:Col14a1 APN 15 55471708 missense unknown
PIT4131001:Col14a1 UTSW 15 55448876 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0173:Col14a1 UTSW 15 55488532 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0359:Col14a1 UTSW 15 55407868 splice site probably benign
R0391:Col14a1 UTSW 15 55446259 unclassified probably benign
R0468:Col14a1 UTSW 15 55388646 missense unknown
R0652:Col14a1 UTSW 15 55344882 missense unknown
R0692:Col14a1 UTSW 15 55341738 missense unknown
R0745:Col14a1 UTSW 15 55338417 missense unknown
R1006:Col14a1 UTSW 15 55519935 missense probably benign 0.04
R1331:Col14a1 UTSW 15 55410188 missense unknown
R1557:Col14a1 UTSW 15 55388579 missense unknown
R1721:Col14a1 UTSW 15 55447462 unclassified probably benign
R1737:Col14a1 UTSW 15 55344961 critical splice donor site probably benign
R1837:Col14a1 UTSW 15 55382495 missense unknown
R1867:Col14a1 UTSW 15 55447462 unclassified probably benign
R1868:Col14a1 UTSW 15 55447462 unclassified probably benign
R1991:Col14a1 UTSW 15 55449940 missense unknown
R2020:Col14a1 UTSW 15 55446181 unclassified probably benign
R2103:Col14a1 UTSW 15 55449940 missense unknown
R2116:Col14a1 UTSW 15 55407764 missense unknown
R2163:Col14a1 UTSW 15 55444645 unclassified probably benign
R2207:Col14a1 UTSW 15 55463686 missense unknown
R2215:Col14a1 UTSW 15 55380842 missense unknown
R2264:Col14a1 UTSW 15 55466690 splice site probably null
R2383:Col14a1 UTSW 15 55447517 unclassified probably benign
R2397:Col14a1 UTSW 15 55338439 missense unknown
R2422:Col14a1 UTSW 15 55449922 missense unknown
R3793:Col14a1 UTSW 15 55363513 missense unknown
R4082:Col14a1 UTSW 15 55437033 missense unknown
R4112:Col14a1 UTSW 15 55363559 missense unknown
R4519:Col14a1 UTSW 15 55388579 missense unknown
R4628:Col14a1 UTSW 15 55449833 nonsense probably null
R4692:Col14a1 UTSW 15 55423468 missense unknown
R4696:Col14a1 UTSW 15 55372602 missense unknown
R4749:Col14a1 UTSW 15 55452336 missense unknown
R5324:Col14a1 UTSW 15 55338445 missense unknown
R5382:Col14a1 UTSW 15 55362436 missense unknown
R5634:Col14a1 UTSW 15 55518298 missense probably damaging 1.00
R5781:Col14a1 UTSW 15 55423512 missense unknown
R5828:Col14a1 UTSW 15 55436976 missense unknown
R5873:Col14a1 UTSW 15 55445786 unclassified probably benign
R5966:Col14a1 UTSW 15 55452383 critical splice donor site probably null
R6106:Col14a1 UTSW 15 55520008 missense probably damaging 1.00
R6135:Col14a1 UTSW 15 55380850 missense unknown
R6319:Col14a1 UTSW 15 55516169 missense probably damaging 0.99
R6475:Col14a1 UTSW 15 55445822 unclassified probably benign
R6540:Col14a1 UTSW 15 55372581 missense unknown
R6893:Col14a1 UTSW 15 55444648 unclassified probably benign
X0023:Col14a1 UTSW 15 55423447 missense unknown
X0063:Col14a1 UTSW 15 55410215 missense unknown
Predicted Primers PCR Primer
(F):5'- CACCGAGACAAGGAGAATTGATCCC -3'
(R):5'- TACATGACAGGCACTTCCTGCGAC -3'

Sequencing Primer
(F):5'- CCCTAGAGTGGAAATGAAGACCTTG -3'
(R):5'- GGGTGTCTATCCACCCTGATG -3'
Posted On2014-04-13