Incidental Mutation 'R1537:Ccdc80'
ID169627
Institutional Source Beutler Lab
Gene Symbol Ccdc80
Ensembl Gene ENSMUSG00000022665
Gene Namecoiled-coil domain containing 80
SynonymsDRO1, Urb, Ssg1, 2610001E17Rik
MMRRC Submission 039576-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R1537 (G1)
Quality Score179
Status Not validated
Chromosome16
Chromosomal Location45093402-45128077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45095936 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 352 (A352T)
Ref Sequence ENSEMBL: ENSMUSP00000097097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061050] [ENSMUST00000099498]
Predicted Effect probably benign
Transcript: ENSMUST00000061050
AA Change: A352T

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000058752
Gene: ENSMUSG00000022665
AA Change: A352T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF4174 141 270 2.2e-31 PFAM
low complexity region 294 308 N/A INTRINSIC
low complexity region 335 380 N/A INTRINSIC
low complexity region 482 497 N/A INTRINSIC
coiled coil region 554 587 N/A INTRINSIC
Pfam:DUF4174 614 748 3.1e-36 PFAM
Pfam:DUF4174 770 901 2.1e-36 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099498
AA Change: A352T

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097097
Gene: ENSMUSG00000022665
AA Change: A352T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF4174 140 271 8.9e-34 PFAM
low complexity region 294 308 N/A INTRINSIC
low complexity region 335 380 N/A INTRINSIC
low complexity region 482 497 N/A INTRINSIC
coiled coil region 554 587 N/A INTRINSIC
Pfam:DUF4174 613 749 1.4e-21 PFAM
Pfam:DUF4174 769 902 3.5e-39 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155800
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased adiposity, hyperglycemia, glucose intolerance, impaired insulin secretion, and altered energy intake and expenditure when fed a high-fat diet. Mice homozygous for a different null allele develop thyroid adenomas and ovarian carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,475 H86L possibly damaging Het
2610507B11Rik T A 11: 78,289,343 Y2150N probably damaging Het
4930519G04Rik A G 5: 114,870,217 T31A probably benign Het
Ahcyl1 A G 3: 107,696,189 F30S probably benign Het
Alox5ap G A 5: 149,265,183 probably null Het
Amtn A G 5: 88,378,870 S53G probably null Het
Arap3 A T 18: 37,989,684 probably null Het
Ash1l T A 3: 89,072,476 V2769E probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bhlha9 C T 11: 76,672,631 S28L probably benign Het
Bmpr2 A G 1: 59,868,126 T793A probably benign Het
Chst2 A T 9: 95,406,141 F51I probably benign Het
Col14a1 A G 15: 55,380,767 N412S unknown Het
Dclk2 T C 3: 86,806,184 I451V probably damaging Het
Ddb2 A G 2: 91,234,889 S64P probably benign Het
Diaph1 A G 18: 37,896,093 probably null Het
Dusp4 G T 8: 34,818,416 R277L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Garem1 A T 18: 21,168,874 probably null Het
Gnpat A G 8: 124,870,816 E39G probably damaging Het
Golgb1 A T 16: 36,898,788 Q352L possibly damaging Het
Hdlbp T C 1: 93,417,374 D803G probably benign Het
Hps1 A G 19: 42,759,704 probably null Het
Ilvbl G A 10: 78,579,731 R327H probably benign Het
Itpr3 A G 17: 27,114,147 D1911G possibly damaging Het
Lmo7 T A 14: 101,929,264 probably benign Het
Mcm10 G A 2: 4,998,780 T542I possibly damaging Het
Med1 A G 11: 98,160,946 V497A probably damaging Het
Mn1 G A 5: 111,454,780 A1295T probably damaging Het
Myh7b A C 2: 155,631,787 D1580A probably damaging Het
Naa20 A G 2: 145,912,518 I101V probably benign Het
Nav3 T C 10: 109,866,985 Y229C probably damaging Het
Obscn T C 11: 59,000,749 R6986G unknown Het
Olfr573-ps1 G A 7: 102,942,340 T79I probably damaging Het
Olfr878 A G 9: 37,919,274 I211V probably benign Het
P2rx3 A G 2: 85,023,481 probably null Het
Papd4 C T 13: 93,175,568 G208D probably damaging Het
Pcdhac2 G A 18: 37,146,486 G840R possibly damaging Het
Pclo A G 5: 14,712,475 N3654S unknown Het
Pcnx2 T A 8: 125,877,449 E689D possibly damaging Het
Pds5a A G 5: 65,647,121 S532P probably benign Het
Phf1 G A 17: 26,935,398 probably null Het
Pkp4 G A 2: 59,214,803 V41M probably damaging Het
Prlr T G 15: 10,328,278 probably null Het
Prr12 G T 7: 45,028,942 A1954D unknown Het
Prtg A G 9: 72,809,757 T127A probably benign Het
Ptprh A G 7: 4,549,699 L884P probably damaging Het
Rnf170 T A 8: 26,139,048 D183E probably benign Het
Rrp12 A T 19: 41,886,803 H339Q probably damaging Het
Rubcnl T G 14: 75,040,827 S350R possibly damaging Het
Sgo2b T A 8: 63,926,502 T1099S possibly damaging Het
Ska2 T C 11: 87,116,119 S17P probably damaging Het
Slc38a2 A G 15: 96,693,153 I243T possibly damaging Het
Sptan1 T A 2: 30,026,022 D2007E possibly damaging Het
Taar5 T A 10: 23,970,722 L6H probably benign Het
Tbata G T 10: 61,183,491 probably null Het
Tmem107 T C 11: 69,072,458 S98P probably damaging Het
Tpst2 A G 5: 112,308,420 D275G possibly damaging Het
Ttc28 G T 5: 111,285,318 G2073W probably damaging Het
Ttc7 T C 17: 87,322,463 V291A possibly damaging Het
Vps13b T A 15: 35,792,181 N2198K possibly damaging Het
Wdr37 A T 13: 8,837,003 D249E probably benign Het
Wdr63 T C 3: 146,042,749 E870G probably damaging Het
Xirp2 G T 2: 67,510,013 C866F probably damaging Het
Zfp990 A G 4: 145,536,996 E188G possibly damaging Het
Zkscan2 A G 7: 123,499,841 S43P possibly damaging Het
Zscan5b A G 7: 6,233,851 R200G probably benign Het
Other mutations in Ccdc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Ccdc80 APN 16 45096264 missense probably benign 0.07
IGL01781:Ccdc80 APN 16 45126130 missense probably damaging 1.00
IGL01945:Ccdc80 APN 16 45118245 missense probably damaging 0.99
IGL02163:Ccdc80 APN 16 45096114 missense probably benign
IGL02223:Ccdc80 APN 16 45095603 missense probably damaging 1.00
IGL02573:Ccdc80 APN 16 45095589 missense probably damaging 1.00
IGL02675:Ccdc80 APN 16 45116332 missense probably damaging 1.00
IGL02689:Ccdc80 APN 16 45096409 nonsense probably null
R0219:Ccdc80 UTSW 16 45096483 missense probably damaging 1.00
R0383:Ccdc80 UTSW 16 45095369 missense probably damaging 1.00
R1726:Ccdc80 UTSW 16 45096005 missense probably benign 0.04
R1885:Ccdc80 UTSW 16 45096720 missense probably benign 0.09
R2021:Ccdc80 UTSW 16 45122912 missense probably damaging 1.00
R2140:Ccdc80 UTSW 16 45127446 missense probably damaging 1.00
R2186:Ccdc80 UTSW 16 45118105 missense probably damaging 1.00
R3896:Ccdc80 UTSW 16 45096621 missense probably benign 0.11
R3941:Ccdc80 UTSW 16 45096092 missense probably benign
R3971:Ccdc80 UTSW 16 45095820 missense probably benign 0.22
R4082:Ccdc80 UTSW 16 45122927 missense probably damaging 1.00
R4322:Ccdc80 UTSW 16 45095588 missense probably damaging 1.00
R4578:Ccdc80 UTSW 16 45095486 missense probably damaging 1.00
R4604:Ccdc80 UTSW 16 45095565 missense probably damaging 1.00
R4868:Ccdc80 UTSW 16 45104413 missense probably damaging 1.00
R4896:Ccdc80 UTSW 16 45095898 missense probably benign
R4921:Ccdc80 UTSW 16 45118167 missense probably damaging 1.00
R4979:Ccdc80 UTSW 16 45116287 missense possibly damaging 0.90
R5452:Ccdc80 UTSW 16 45118165 missense probably damaging 1.00
R5454:Ccdc80 UTSW 16 45127225 nonsense probably null
R5594:Ccdc80 UTSW 16 45116263 missense probably benign 0.00
R5661:Ccdc80 UTSW 16 45127445 missense probably damaging 1.00
R5701:Ccdc80 UTSW 16 45116378 missense possibly damaging 0.51
R6106:Ccdc80 UTSW 16 45096710 missense probably benign 0.00
R6393:Ccdc80 UTSW 16 45096465 missense possibly damaging 0.88
R6633:Ccdc80 UTSW 16 45094908 missense possibly damaging 0.95
R6943:Ccdc80 UTSW 16 45095082 missense probably benign 0.00
R7021:Ccdc80 UTSW 16 45104441 missense probably damaging 1.00
R7030:Ccdc80 UTSW 16 45122889 missense possibly damaging 0.60
X0012:Ccdc80 UTSW 16 45096425 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CCATCCGCAGGATCGAGAAAATCAG -3'
(R):5'- TCTGTTGCTCCTTCCGAGGTAGAG -3'

Sequencing Primer
(F):5'- CATAGAGGGCCATGTAGTCCAG -3'
(R):5'- AGGGTATAGCTGCTCTGAGAC -3'
Posted On2014-04-13