Incidental Mutation 'R1538:Dnah7a'
ID169640
Institutional Source Beutler Lab
Gene Symbol Dnah7a
Ensembl Gene ENSMUSG00000096141
Gene Namedynein, axonemal, heavy chain 7A
SynonymsDnahc7a, Dnahc7, LOC381341
MMRRC Submission 039577-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R1538 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location53397006-53706784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53495989 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2704 (V2704A)
Ref Sequence ENSEMBL: ENSMUSP00000092571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094964]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094964
AA Change: V2704A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092571
Gene: ENSMUSG00000096141
AA Change: V2704A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 504 537 N/A INTRINSIC
Pfam:DHC_N2 756 1165 3.1e-149 PFAM
AAA 1320 1459 2.46e-1 SMART
Blast:AAA 1601 1879 1e-87 BLAST
AAA 1968 2116 5.39e-2 SMART
Pfam:AAA_8 2303 2574 6.9e-75 PFAM
Pfam:MT 2586 2936 2.1e-55 PFAM
Pfam:AAA_9 2957 3182 1.3e-98 PFAM
Pfam:Dynein_heavy 3318 4020 2.3e-287 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,065,401 R117L probably benign Het
4930447C04Rik G A 12: 72,881,346 A537V possibly damaging Het
4930579F01Rik A C 3: 138,183,756 D33E probably damaging Het
9530053A07Rik A T 7: 28,155,492 I1848F probably damaging Het
Acnat1 T C 4: 49,447,835 K249E possibly damaging Het
Ankrd13a T C 5: 114,804,234 I526T possibly damaging Het
Aplp1 C A 7: 30,436,027 E535D probably benign Het
Armc8 T A 9: 99,505,290 H425L probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asprv1 C T 6: 86,628,636 Q155* probably null Het
Atl1 A G 12: 69,926,188 Q94R probably benign Het
Atp2a2 A G 5: 122,457,377 L970P probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Bod1l A G 5: 41,816,429 M2514T probably benign Het
Cacfd1 T A 2: 27,018,939 D97E probably benign Het
Cacna1e A G 1: 154,561,758 L344P probably damaging Het
Cacna2d2 C A 9: 107,517,416 R596S probably damaging Het
Catip C A 1: 74,364,652 S176* probably null Het
Cdcp1 G A 9: 123,173,588 S806L probably damaging Het
Cdk6 A T 5: 3,520,675 I289L probably benign Het
Cers3 C T 7: 66,781,823 T182I probably damaging Het
Cfap46 T A 7: 139,683,008 N43I probably null Het
Clec4n A T 6: 123,230,033 R5S possibly damaging Het
Cnr2 G T 4: 135,916,701 S30I probably benign Het
Col18a1 C T 10: 77,071,336 G870E probably damaging Het
Cpne6 T C 14: 55,515,220 V289A possibly damaging Het
Crym G A 7: 120,197,715 L141F probably benign Het
Cxxc5 T C 18: 35,858,569 S8P unknown Het
Dido1 A C 2: 180,684,970 S453R possibly damaging Het
Dnah2 A C 11: 69,477,202 S1770R probably benign Het
Eml5 T C 12: 98,794,276 N1738S probably damaging Het
Eri3 A G 4: 117,582,639 T138A possibly damaging Het
Ext2 C T 2: 93,707,287 E585K probably damaging Het
Fam35a C G 14: 34,268,876 Q24H probably damaging Het
Fam84b A G 15: 60,823,649 C83R probably damaging Het
Fbxw19 T A 9: 109,494,988 S38C probably damaging Het
Fmo6 G A 1: 162,926,106 P156S probably damaging Het
Frem3 T C 8: 80,612,710 L544P probably damaging Het
Frem3 A T 8: 80,613,135 I686F probably benign Het
Gabra1 T C 11: 42,140,350 Y251C probably benign Het
Gemin4 G T 11: 76,211,161 Q925K probably benign Het
Gm18856 T A 13: 13,964,689 probably benign Het
Gnb1 A T 4: 155,551,714 T164S probably benign Het
Gpx6 A G 13: 21,313,652 D31G possibly damaging Het
Gzmd A C 14: 56,130,345 I157S probably benign Het
Il31ra T A 13: 112,547,466 N43I possibly damaging Het
Irak3 T C 10: 120,165,130 T297A probably benign Het
Kank2 T C 9: 21,774,631 D649G probably damaging Het
Kif3b AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 2: 153,317,462 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl18 A G 9: 110,446,747 F111S probably damaging Het
Lrp5 A G 19: 3,647,585 S319P possibly damaging Het
Marc1 T C 1: 184,802,002 E223G probably damaging Het
Mettl15 T C 2: 109,131,665 probably null Het
Ncoa1 T C 12: 4,270,748 Q1107R possibly damaging Het
Ncoa7 T G 10: 30,694,211 M251L probably damaging Het
Nos2 A T 11: 78,956,570 M1023L probably benign Het
Nup107 T C 10: 117,790,494 K25E probably damaging Het
Olfr1491 A T 19: 13,705,496 Y223F probably damaging Het
Olfr177 T A 16: 58,872,898 N84I probably damaging Het
Olfr482 T A 7: 108,095,286 I95F probably damaging Het
Olfr591 A G 7: 103,172,986 I217T probably damaging Het
Olfr711 A T 7: 106,971,983 Y120* probably null Het
Olfr776 T C 10: 129,261,213 I84T probably damaging Het
Parm1 G A 5: 91,594,447 E225K possibly damaging Het
Pdzd2 A C 15: 12,372,961 S2363A probably damaging Het
Piezo1 A G 8: 122,491,403 L1199P probably damaging Het
Prpsap1 A T 11: 116,479,708 M141K probably benign Het
Prss29 A T 17: 25,320,283 M1L possibly damaging Het
Pter T A 2: 12,978,606 S141T probably benign Het
Ptpru A T 4: 131,774,351 D1181E probably damaging Het
Rab3ip T A 10: 116,939,254 Q66H probably damaging Het
Rgs12 A T 5: 35,021,167 T779S probably damaging Het
Rgs22 A G 15: 36,048,776 F786S probably damaging Het
Rnasel A T 1: 153,760,794 D640V possibly damaging Het
Rp1 T C 1: 4,345,676 T1738A probably damaging Het
Sacs T C 14: 61,210,059 S3185P probably damaging Het
Scnn1a T A 6: 125,338,893 D321E possibly damaging Het
Sec31b G C 19: 44,518,586 L1014V probably benign Het
Serpinb10 A G 1: 107,540,960 Y111C probably damaging Het
Siglecg A G 7: 43,417,889 K627E possibly damaging Het
Sigmar1 T C 4: 41,740,845 I95V probably benign Het
Sirpb1b T A 3: 15,548,759 T88S possibly damaging Het
Spire2 T G 8: 123,358,156 L245R probably damaging Het
Stard9 C A 2: 120,696,711 P1150T probably benign Het
Stat6 C A 10: 127,653,256 T380N probably damaging Het
Sult3a1 G A 10: 33,870,170 G162E probably benign Het
Surf4 T C 2: 26,933,698 probably null Het
Tacc2 T C 7: 130,625,419 M1278T probably benign Het
Tacr2 T A 10: 62,261,327 probably null Het
Tcaf1 A T 6: 42,678,989 V351E probably damaging Het
Tmcc2 A G 1: 132,380,980 S59P probably damaging Het
Tmem17 G A 11: 22,517,266 S60N possibly damaging Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Tmprss7 A T 16: 45,679,390 I307N probably benign Het
Treml2 A T 17: 48,302,758 T73S possibly damaging Het
Trrap A G 5: 144,837,202 H2876R possibly damaging Het
Tyw3 A G 3: 154,596,869 I53T probably damaging Het
Ugp2 A G 11: 21,333,791 I92T possibly damaging Het
Vmn2r66 A T 7: 84,994,958 M748K possibly damaging Het
Vmn2r82 T C 10: 79,356,744 S52P possibly damaging Het
Wdr37 A T 13: 8,836,792 S320T probably benign Het
Zbtb16 A T 9: 48,832,283 M243K probably benign Het
Zfr C T 15: 12,150,243 T432I possibly damaging Het
Other mutations in Dnah7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dnah7a APN 1 53419684 missense probably damaging 0.99
IGL00510:Dnah7a APN 1 53501542 missense probably damaging 1.00
IGL00545:Dnah7a APN 1 53457746 missense possibly damaging 0.87
IGL01320:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01322:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01357:Dnah7a APN 1 53662381 missense probably benign
IGL01417:Dnah7a APN 1 53584600 missense probably benign 0.01
IGL01508:Dnah7a APN 1 53627072 missense probably benign 0.00
IGL01511:Dnah7a APN 1 53419595 missense probably damaging 1.00
IGL01545:Dnah7a APN 1 53518782 missense probably benign
IGL01575:Dnah7a APN 1 53427820 splice site probably benign
IGL01667:Dnah7a APN 1 53547292 missense probably damaging 1.00
IGL01712:Dnah7a APN 1 53423270 missense probably benign 0.23
IGL01824:Dnah7a APN 1 53504270 missense probably benign
IGL01829:Dnah7a APN 1 53618068 missense possibly damaging 0.64
IGL01861:Dnah7a APN 1 53640349 missense probably benign 0.01
IGL01861:Dnah7a APN 1 53584449 splice site probably benign
IGL01984:Dnah7a APN 1 53702015 splice site probably null
IGL02056:Dnah7a APN 1 53504342 missense probably benign 0.17
IGL02069:Dnah7a APN 1 53561894 splice site probably benign
IGL02072:Dnah7a APN 1 53605827 missense probably damaging 1.00
IGL02110:Dnah7a APN 1 53411580 missense possibly damaging 0.52
IGL02120:Dnah7a APN 1 53495717 missense possibly damaging 0.46
IGL02128:Dnah7a APN 1 53437513 missense probably damaging 1.00
IGL02135:Dnah7a APN 1 53623473 missense probably benign 0.01
IGL02151:Dnah7a APN 1 53472864 missense probably benign 0.08
IGL02156:Dnah7a APN 1 53419723 missense probably benign 0.27
IGL02270:Dnah7a APN 1 53472893 missense possibly damaging 0.93
IGL02282:Dnah7a APN 1 53643510 missense possibly damaging 0.93
IGL02328:Dnah7a APN 1 53524937 critical splice donor site probably null
IGL02370:Dnah7a APN 1 53635397 missense probably benign 0.00
IGL02420:Dnah7a APN 1 53686543 missense probably benign
IGL02458:Dnah7a APN 1 53618328 nonsense probably null
IGL02489:Dnah7a APN 1 53647322 missense possibly damaging 0.94
IGL02554:Dnah7a APN 1 53618046 missense possibly damaging 0.93
IGL02578:Dnah7a APN 1 53432915 missense probably benign 0.00
IGL02646:Dnah7a APN 1 53525035 missense probably damaging 0.99
IGL02675:Dnah7a APN 1 53504024 missense possibly damaging 0.96
IGL02688:Dnah7a APN 1 53444472 missense possibly damaging 0.93
IGL02858:Dnah7a APN 1 53472959 splice site probably benign
IGL02874:Dnah7a APN 1 53605814 missense possibly damaging 0.70
IGL02887:Dnah7a APN 1 53522360 missense possibly damaging 0.46
IGL02894:Dnah7a APN 1 53577328 missense probably benign 0.27
IGL02926:Dnah7a APN 1 53495950 missense possibly damaging 0.64
IGL03113:Dnah7a APN 1 53433004 missense possibly damaging 0.64
IGL03156:Dnah7a APN 1 53605824 missense probably damaging 0.97
IGL03195:Dnah7a APN 1 53419607 missense probably damaging 1.00
IGL03209:Dnah7a APN 1 53686614 splice site probably benign
IGL03214:Dnah7a APN 1 53522209 critical splice donor site probably null
IGL03242:Dnah7a APN 1 53620723 missense probably benign 0.02
IGL03251:Dnah7a APN 1 53647274 missense probably benign
IGL03265:Dnah7a APN 1 53528848 missense probably benign
IGL03277:Dnah7a APN 1 53630322 missense probably benign 0.00
IGL03278:Dnah7a APN 1 53496965 missense probably benign 0.07
IGL03356:Dnah7a APN 1 53503934 missense probably benign 0.01
R0046:Dnah7a UTSW 1 53456874 splice site probably null
R0051:Dnah7a UTSW 1 53521086 splice site probably benign
R0082:Dnah7a UTSW 1 53518708 missense probably damaging 1.00
R0111:Dnah7a UTSW 1 53468684 missense probably benign 0.03
R0122:Dnah7a UTSW 1 53397142 missense probably damaging 1.00
R0245:Dnah7a UTSW 1 53501526 missense probably damaging 1.00
R0278:Dnah7a UTSW 1 53504146 missense probably benign 0.00
R0309:Dnah7a UTSW 1 53405690 missense probably damaging 0.97
R0334:Dnah7a UTSW 1 53433054 missense possibly damaging 0.61
R0392:Dnah7a UTSW 1 53504198 missense probably damaging 0.97
R0452:Dnah7a UTSW 1 53605819 missense probably benign 0.00
R0511:Dnah7a UTSW 1 53497126 missense probably benign
R0576:Dnah7a UTSW 1 53636087 missense probably benign 0.12
R0592:Dnah7a UTSW 1 53456612 missense possibly damaging 0.91
R0628:Dnah7a UTSW 1 53497105 missense probably benign 0.18
R0689:Dnah7a UTSW 1 53620681 nonsense probably null
R0735:Dnah7a UTSW 1 53544511 missense possibly damaging 0.70
R0800:Dnah7a UTSW 1 53565696 missense probably damaging 1.00
R0829:Dnah7a UTSW 1 53504079 missense probably benign 0.07
R0842:Dnah7a UTSW 1 53501674 missense possibly damaging 0.88
R0879:Dnah7a UTSW 1 53427860 missense possibly damaging 0.85
R1331:Dnah7a UTSW 1 53468669 missense probably damaging 0.99
R1418:Dnah7a UTSW 1 53647236 splice site probably benign
R1421:Dnah7a UTSW 1 53540873 splice site probably benign
R1445:Dnah7a UTSW 1 53528797 missense probably benign 0.02
R1473:Dnah7a UTSW 1 53496014 missense probably benign 0.00
R1742:Dnah7a UTSW 1 53456684 missense probably benign 0.39
R1754:Dnah7a UTSW 1 53504185 missense probably benign 0.18
R1754:Dnah7a UTSW 1 53561900 critical splice donor site probably null
R1773:Dnah7a UTSW 1 53432887 splice site probably null
R1779:Dnah7a UTSW 1 53577223 missense probably benign
R1816:Dnah7a UTSW 1 53631742 splice site probably benign
R1817:Dnah7a UTSW 1 53559148 missense probably benign
R1818:Dnah7a UTSW 1 53559148 missense probably benign
R1819:Dnah7a UTSW 1 53559148 missense probably benign
R1873:Dnah7a UTSW 1 53456532 splice site probably benign
R1875:Dnah7a UTSW 1 53456532 splice site probably benign
R1884:Dnah7a UTSW 1 53541000 missense probably damaging 0.99
R1902:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1903:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1908:Dnah7a UTSW 1 53631562 missense probably benign
R1959:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1960:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1985:Dnah7a UTSW 1 53503934 missense probably benign 0.01
R1992:Dnah7a UTSW 1 53582676 missense possibly damaging 0.91
R2037:Dnah7a UTSW 1 53582582 missense probably benign 0.00
R2074:Dnah7a UTSW 1 53457696 missense probably benign 0.45
R2076:Dnah7a UTSW 1 53503809 missense probably benign 0.01
R2124:Dnah7a UTSW 1 53496942 missense possibly damaging 0.58
R2191:Dnah7a UTSW 1 53605875 missense possibly damaging 0.54
R2211:Dnah7a UTSW 1 53479773 missense probably benign 0.21
R2220:Dnah7a UTSW 1 53521174 missense probably benign
R2355:Dnah7a UTSW 1 53582502 missense probably benign 0.00
R2495:Dnah7a UTSW 1 53605881 missense probably damaging 1.00
R2901:Dnah7a UTSW 1 53427872 missense probably damaging 0.99
R2911:Dnah7a UTSW 1 53427824 critical splice donor site probably null
R2993:Dnah7a UTSW 1 53503554 missense probably damaging 1.00
R3522:Dnah7a UTSW 1 53618116 missense probably damaging 1.00
R3683:Dnah7a UTSW 1 53444516 missense probably benign
R3723:Dnah7a UTSW 1 53447346 missense probably benign 0.04
R3847:Dnah7a UTSW 1 53501656 missense probably benign 0.01
R4002:Dnah7a UTSW 1 53631681 missense probably benign
R4009:Dnah7a UTSW 1 53525005 missense probably damaging 1.00
R4063:Dnah7a UTSW 1 53425217 missense probably benign
R4193:Dnah7a UTSW 1 53447334 missense probably benign 0.00
R4236:Dnah7a UTSW 1 53447365 missense probably benign 0.00
R4399:Dnah7a UTSW 1 53518727 missense probably damaging 1.00
R4469:Dnah7a UTSW 1 53444526 missense probably benign 0.01
R4494:Dnah7a UTSW 1 53449038 missense probably benign 0.01
R4569:Dnah7a UTSW 1 53411659 missense probably benign 0.01
R4609:Dnah7a UTSW 1 53456657 missense possibly damaging 0.80
R4632:Dnah7a UTSW 1 53427951 missense probably damaging 0.97
R4703:Dnah7a UTSW 1 53447317 critical splice donor site probably null
R4781:Dnah7a UTSW 1 53425208 missense probably benign 0.28
R4854:Dnah7a UTSW 1 53706729 utr 5 prime probably benign
R4932:Dnah7a UTSW 1 53503578 missense possibly damaging 0.90
R4976:Dnah7a UTSW 1 53698692 missense probably benign
R5000:Dnah7a UTSW 1 53567042 missense probably damaging 1.00
R5023:Dnah7a UTSW 1 53647248 nonsense probably null
R5026:Dnah7a UTSW 1 53662498 missense probably damaging 0.99
R5050:Dnah7a UTSW 1 53497096 missense probably benign 0.01
R5119:Dnah7a UTSW 1 53698692 missense probably benign
R5151:Dnah7a UTSW 1 53620770 missense probably benign 0.00
R5155:Dnah7a UTSW 1 53643495 missense probably benign 0.01
R5180:Dnah7a UTSW 1 53423287 missense probably damaging 0.97
R5228:Dnah7a UTSW 1 53437609 critical splice acceptor site probably null
R5237:Dnah7a UTSW 1 53447531 intron probably null
R5267:Dnah7a UTSW 1 53479692 missense probably damaging 1.00
R5334:Dnah7a UTSW 1 53503646 missense probably benign 0.00
R5358:Dnah7a UTSW 1 53547172 missense probably damaging 1.00
R5401:Dnah7a UTSW 1 53631653 missense probably benign 0.01
R5412:Dnah7a UTSW 1 53635344 missense probably benign
R5496:Dnah7a UTSW 1 53457768 missense probably benign
R5531:Dnah7a UTSW 1 53419748 missense possibly damaging 0.50
R5536:Dnah7a UTSW 1 53425253 missense probably benign
R5543:Dnah7a UTSW 1 53504069 missense probably damaging 1.00
R5597:Dnah7a UTSW 1 53534452 missense probably benign 0.00
R5609:Dnah7a UTSW 1 53582594 missense probably benign 0.03
R5643:Dnah7a UTSW 1 53405707 missense probably benign
R5644:Dnah7a UTSW 1 53540979 missense probably benign 0.33
R5689:Dnah7a UTSW 1 53405698 missense possibly damaging 0.87
R5715:Dnah7a UTSW 1 53413778 missense probably damaging 1.00
R5780:Dnah7a UTSW 1 53483319 missense probably benign 0.03
R5893:Dnah7a UTSW 1 53457785 missense possibly damaging 0.66
R5946:Dnah7a UTSW 1 53559308 missense probably damaging 1.00
R5995:Dnah7a UTSW 1 53620670 missense probably benign 0.00
R6102:Dnah7a UTSW 1 53559140 missense probably benign 0.00
R6108:Dnah7a UTSW 1 53456845 missense probably damaging 1.00
R6133:Dnah7a UTSW 1 53419655 missense probably benign 0.05
R6168:Dnah7a UTSW 1 53411568 missense probably damaging 1.00
R6175:Dnah7a UTSW 1 53433022 missense probably damaging 1.00
R6211:Dnah7a UTSW 1 53419636 missense probably damaging 0.99
R6282:Dnah7a UTSW 1 53503601 missense probably damaging 1.00
R6329:Dnah7a UTSW 1 53541114 missense probably damaging 1.00
R6344:Dnah7a UTSW 1 53397190 missense probably benign 0.02
R6530:Dnah7a UTSW 1 53503697 missense probably benign 0.04
R6574:Dnah7a UTSW 1 53456534 critical splice donor site probably null
R6608:Dnah7a UTSW 1 53525118 missense probably benign
R6625:Dnah7a UTSW 1 53565757 missense probably benign 0.05
R6661:Dnah7a UTSW 1 53623450 missense probably benign 0.00
R6681:Dnah7a UTSW 1 53521226 critical splice acceptor site probably null
R6747:Dnah7a UTSW 1 53636062 missense probably benign 0.01
R6774:Dnah7a UTSW 1 53698651 missense probably benign
R6823:Dnah7a UTSW 1 53456704 missense probably benign
R6900:Dnah7a UTSW 1 53662351 missense probably damaging 0.97
R6940:Dnah7a UTSW 1 53631677 missense probably benign 0.09
R6956:Dnah7a UTSW 1 53577287 missense probably benign 0.02
R6978:Dnah7a UTSW 1 53662367 missense probably null
R6988:Dnah7a UTSW 1 53582625 missense possibly damaging 0.62
X0027:Dnah7a UTSW 1 53472930 missense probably damaging 1.00
Z1088:Dnah7a UTSW 1 53468643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGCCCCGACAGGTTTCTTCTC -3'
(R):5'- TGCTGCCATTTCTGCCCAACACAG -3'

Sequencing Primer
(F):5'- CGGATCTTCTCTGGAACAAAGTC -3'
(R):5'- TTTCTGCCCAACACAGAAAATGTC -3'
Posted On2014-04-13