Incidental Mutation 'R1538:1110002E22Rik'
List |< first << previous [record 99 of 386652] next >> last >|
ID169664
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission 039577-MU
Accession Numbers
Stock #R1538 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 138065401 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 117 (R117L)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163080]
Predicted Effect probably benign
Transcript: ENSMUST00000163080
AA Change: R117L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: R117L

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik G A 12: 72,881,346 A537V possibly damaging Het
4930579F01Rik A C 3: 138,183,756 D33E probably damaging Het
9530053A07Rik A T 7: 28,155,492 I1848F probably damaging Het
Acnat1 T C 4: 49,447,835 K249E possibly damaging Het
Als2 A T 1: 59,206,599 probably benign Het
Ankrd13a T C 5: 114,804,234 I526T possibly damaging Het
Aplp1 C A 7: 30,436,027 E535D probably benign Het
Armc8 T A 9: 99,505,290 H425L probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asprv1 C T 6: 86,628,636 Q155* probably null Het
Atl1 A G 12: 69,926,188 Q94R probably benign Het
Atp2a2 A G 5: 122,457,377 L970P probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Bod1l A G 5: 41,816,429 M2514T probably benign Het
Cacfd1 T A 2: 27,018,939 D159E probably benign Het
Cacna1e A G 1: 154,561,758 L36P possibly damaging Het
Cacna2d2 C A 9: 107,517,416 R596S probably damaging Het
Catip C A 1: 74,364,652 S157* probably null Het
Cdcp1 G A 9: 123,173,588 S806L probably damaging Het
Cdk6 A T 5: 3,520,675 I289L probably benign Het
Cers3 C T 7: 66,781,823 T182I probably damaging Het
Cfap46 T A 7: 139,683,008 N101I probably damaging Het
Clec4n A T 6: 123,230,033 R5S probably benign Het
Cnr2 G T 4: 135,916,701 S30I probably benign Het
Col18a1 C T 10: 77,071,336 G1117E probably damaging Het
Cpne6 T C 14: 55,515,220 V289A possibly damaging Het
Crym G A 7: 120,197,715 L141F probably benign Het
CT009546.1 T A 13: 13,964,689 H352L probably damaging Het
Cxxc5 T C 18: 35,858,569 S8P unknown Het
Dido1 A C 2: 180,684,970 S453R possibly damaging Het
Dnah2 A C 11: 69,477,202 S1770R probably benign Het
Dnah7a A G 1: 53,495,989 V2704A possibly damaging Het
Dpp10 G A 1: 123,432,920 probably benign Het
Eml5 T C 12: 98,794,276 N1738S probably damaging Het
Eri3 A G 4: 117,582,639 T177A possibly damaging Het
Ext2 C T 2: 93,707,287 E585K probably damaging Het
Fam171b T A 2: 83,858,213 probably benign Het
Fam35a C G 14: 34,268,876 Q24H probably damaging Het
Fam84b A G 15: 60,823,649 C83R probably damaging Het
Fbxw19 T A 9: 109,494,988 S38C probably damaging Het
Fmo6 G A 1: 162,926,106 P156S probably damaging Het
Frem3 T C 8: 80,612,710 L544P probably damaging Het
Frem3 A T 8: 80,613,135 I686F probably benign Het
Gabra1 T C 11: 42,140,350 Y251C probably benign Het
Gabrr3 A G 16: 59,433,436 probably benign Het
Gemin4 G T 11: 76,211,161 Q925K probably benign Het
Gnb1 A T 4: 155,551,714 T164S probably benign Het
Gpx6 A G 13: 21,313,652 D31G possibly damaging Het
Gstp2 G A 19: 4,041,095 probably benign Het
Gzmd A C 14: 56,130,345 I157S probably benign Het
Il31ra T A 13: 112,547,466 N124I possibly damaging Het
Irak3 T C 10: 120,165,130 T297A probably benign Het
Kank2 T C 9: 21,774,631 D649G probably damaging Het
Kif3b AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 2: 153,317,462 unknown Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl18 A G 9: 110,446,747 F176S probably damaging Het
L3hypdh T C 12: 72,084,638 probably benign Het
Lrp5 A G 19: 3,647,585 S319P probably benign Het
Marc1 T C 1: 184,802,002 E223G probably damaging Het
Mettl15 T C 2: 109,131,665 probably null Het
Mttp A G 3: 138,107,095 probably benign Het
Ncoa1 T C 12: 4,270,748 Q1107R possibly damaging Het
Ncoa7 T G 10: 30,694,211 M251L probably damaging Het
Nfkb2 T G 19: 46,309,651 probably benign Het
Nin A G 12: 70,038,532 probably benign Het
Nos2 A T 11: 78,956,570 M1023L probably benign Het
Nup107 T C 10: 117,790,494 K25E possibly damaging Het
Nup210l T A 3: 90,137,007 probably benign Het
Olfr1491 A T 19: 13,705,496 Y223F probably damaging Het
Olfr177 T A 16: 58,872,898 N84I probably damaging Het
Olfr482 T A 7: 108,095,286 I95F probably damaging Het
Olfr591 A G 7: 103,172,986 I217T probably damaging Het
Olfr711 A T 7: 106,971,983 Y120* probably null Het
Olfr776 T C 10: 129,261,213 I84T probably damaging Het
Parm1 G A 5: 91,594,447 E225K possibly damaging Het
Pdzd2 A C 15: 12,372,961 S2363A probably damaging Het
Piezo1 A G 8: 122,491,403 L1198P probably damaging Het
Pkd1 T C 17: 24,580,866 probably benign Het
Ppa2 C A 3: 133,330,517 probably benign Het
Prpsap1 A T 11: 116,479,708 M136K probably benign Het
Prss29 A T 17: 25,320,283 M1L probably null Het
Pter T A 2: 12,978,606 S141T probably benign Het
Ptpru A T 4: 131,774,351 D1191E probably damaging Het
Rab3ip T A 10: 116,939,254 Q66H probably damaging Het
Rasal1 A T 5: 120,664,136 probably benign Het
Rgs12 A T 5: 35,021,167 T779S probably damaging Het
Rgs22 A G 15: 36,048,776 F910S probably damaging Het
Rnasel A T 1: 153,760,794 D640V possibly damaging Het
Rp1 T C 1: 4,345,676 T1738A probably damaging Het
Rpl23a-ps1 A C 1: 45,981,909 D121A possibly damaging Het
Sacs T C 14: 61,210,059 S3185P probably damaging Het
Scnn1a T A 6: 125,338,893 D428E probably benign Het
Sec31b G C 19: 44,518,586 L1014V probably benign Het
Sec31b C A 19: 44,532,280 probably benign Het
Serpinb10 A G 1: 107,540,960 Y111C probably damaging Het
Sh2d3c C T 2: 32,721,207 probably benign Het
Siglecg A G 7: 43,417,889 K627E possibly damaging Het
Sigmar1 T C 4: 41,740,845 I95V probably benign Het
Sirpb1b T A 3: 15,548,759 T88S possibly damaging Het
Spire2 T G 8: 123,358,156 L345R probably damaging Het
Stard9 C A 2: 120,696,711 P1150T probably benign Het
Stat6 C A 10: 127,653,256 T380N probably damaging Het
Sult3a1 G A 10: 33,870,170 G162E probably benign Het
Surf4 T C 2: 26,933,698 probably null Het
Tacc2 T C 7: 130,625,419 M1278T probably benign Het
Tacr2 T A 10: 62,261,327 probably null Het
Tcaf1 A T 6: 42,678,989 V351E probably damaging Het
Tmcc2 A G 1: 132,380,980 S137P probably damaging Het
Tmem17 G A 11: 22,517,266 S60N possibly damaging Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Tmprss7 A T 16: 45,679,390 I307N probably benign Het
Treml2 A T 17: 48,302,758 T73S possibly damaging Het
Trrap A G 5: 144,837,202 H2894R possibly damaging Het
Tyw3 A G 3: 154,596,869 I53T probably damaging Het
Ugp2 A G 11: 21,333,791 I92T possibly damaging Het
Vmn2r66 A T 7: 84,994,958 M748K possibly damaging Het
Vmn2r82 T C 10: 79,356,744 S52P possibly damaging Het
Wdr37 A T 13: 8,836,792 S320T probably benign Het
Zbtb16 A T 9: 48,832,283 M243K probably benign Het
Zfr C T 15: 12,150,243 T432I possibly damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion unknown
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGCAACTGGACTGGACAGC -3'
(R):5'- CATACTTGGCTTCAGGCAGGGTAG -3'

Sequencing Primer
(F):5'- TGGACAGCTCAGCAGCAG -3'
(R):5'- CTGACGGCTCAGGTAGTG -3'
Posted OnApr 13, 2014