Incidental Mutation 'R1538:Col18a1'
ID169711
Institutional Source Beutler Lab
Gene Symbol Col18a1
Ensembl Gene ENSMUSG00000001435
Gene Namecollagen, type XVIII, alpha 1
Synonymsendostatin
MMRRC Submission 039577-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1538 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location77052178-77166548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 77071336 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 870 (G870E)
Ref Sequence ENSEMBL: ENSMUSP00000101049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072755] [ENSMUST00000081654] [ENSMUST00000105409]
Predicted Effect probably damaging
Transcript: ENSMUST00000072755
AA Change: G1117E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072538
Gene: ENSMUSG00000001435
AA Change: G1117E

DomainStartEndE-ValueType
Pfam:DUF959 16 218 6.8e-104 PFAM
low complexity region 295 307 N/A INTRINSIC
FRI 369 484 4.03e-47 SMART
TSPN 492 680 4.25e-72 SMART
LamG 541 679 2.17e-2 SMART
low complexity region 699 715 N/A INTRINSIC
low complexity region 719 734 N/A INTRINSIC
low complexity region 739 751 N/A INTRINSIC
Pfam:Collagen 820 881 5.5e-11 PFAM
low complexity region 921 942 N/A INTRINSIC
Pfam:Collagen 951 1008 6.1e-10 PFAM
Pfam:Collagen 988 1053 1.4e-8 PFAM
Pfam:Collagen 1060 1117 7.3e-10 PFAM
low complexity region 1132 1147 N/A INTRINSIC
low complexity region 1166 1181 N/A INTRINSIC
low complexity region 1186 1202 N/A INTRINSIC
Pfam:Collagen 1207 1267 8.2e-10 PFAM
low complexity region 1275 1288 N/A INTRINSIC
low complexity region 1301 1319 N/A INTRINSIC
low complexity region 1358 1393 N/A INTRINSIC
low complexity region 1397 1414 N/A INTRINSIC
low complexity region 1417 1433 N/A INTRINSIC
low complexity region 1441 1454 N/A INTRINSIC
Pfam:Endostatin 1461 1769 4.4e-116 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081654
AA Change: G658E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080358
Gene: ENSMUSG00000001435
AA Change: G658E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
TSPN 33 221 4.25e-72 SMART
LamG 82 220 2.17e-2 SMART
low complexity region 240 256 N/A INTRINSIC
low complexity region 260 275 N/A INTRINSIC
low complexity region 280 292 N/A INTRINSIC
Pfam:Collagen 359 422 1.6e-10 PFAM
low complexity region 462 483 N/A INTRINSIC
Pfam:Collagen 492 549 1.6e-9 PFAM
Pfam:Collagen 529 594 3.3e-8 PFAM
Pfam:Collagen 601 658 1.9e-9 PFAM
Pfam:Collagen 631 689 4e-8 PFAM
Pfam:Collagen 701 752 1.7e-7 PFAM
Pfam:Collagen 748 808 2.2e-9 PFAM
low complexity region 816 829 N/A INTRINSIC
low complexity region 842 860 N/A INTRINSIC
low complexity region 899 934 N/A INTRINSIC
low complexity region 938 955 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 982 995 N/A INTRINSIC
Pfam:Endostatin 999 1315 8.2e-151 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105409
AA Change: G870E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101049
Gene: ENSMUSG00000001435
AA Change: G870E

DomainStartEndE-ValueType
Pfam:DUF959 16 219 3.6e-100 PFAM
TSPN 245 433 4.25e-72 SMART
LamG 294 432 2.17e-2 SMART
low complexity region 452 468 N/A INTRINSIC
low complexity region 472 487 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
low complexity region 542 613 N/A INTRINSIC
low complexity region 630 648 N/A INTRINSIC
low complexity region 674 695 N/A INTRINSIC
Pfam:Collagen 700 761 5.4e-9 PFAM
Pfam:Collagen 741 806 4e-8 PFAM
Pfam:Collagen 813 874 2.1e-10 PFAM
Pfam:Collagen 846 901 1.2e-7 PFAM
Pfam:Collagen 913 964 2.1e-7 PFAM
Pfam:Collagen 960 1020 2.6e-9 PFAM
low complexity region 1028 1041 N/A INTRINSIC
low complexity region 1054 1072 N/A INTRINSIC
low complexity region 1111 1146 N/A INTRINSIC
low complexity region 1150 1167 N/A INTRINSIC
low complexity region 1170 1186 N/A INTRINSIC
low complexity region 1194 1207 N/A INTRINSIC
Pfam:Endostatin 1211 1527 1.1e-150 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XVIII collagen. This collagen is one of the multiplexins, extracellular matrix proteins that contain multiple triple-helix domains (collagenous domains) interrupted by non-collagenous domains. A long isoform of the protein has an N-terminal domain that is homologous to the extracellular part of frizzled receptors. Proteolytic processing at several endogenous cleavage sites in the C-terminal domain results in production of endostatin, a potent antiangiogenic protein that is able to inhibit angiogenesis and tumor growth. Mutations in this gene are associated with Knobloch syndrome. The main features of this syndrome involve retinal abnormalities, so type XVIII collagen may play an important role in retinal structure and in neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in hyaloid vessel regression, attenuated visual function, abnormal electroretinograms, broad proximal tubule basement membrane, podocyte effacement, and softened glomeruli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,065,401 R117L probably benign Het
4930447C04Rik G A 12: 72,881,346 A537V possibly damaging Het
4930579F01Rik A C 3: 138,183,756 D33E probably damaging Het
9530053A07Rik A T 7: 28,155,492 I1848F probably damaging Het
Acnat1 T C 4: 49,447,835 K249E possibly damaging Het
Ankrd13a T C 5: 114,804,234 I526T possibly damaging Het
Aplp1 C A 7: 30,436,027 E535D probably benign Het
Armc8 T A 9: 99,505,290 H425L probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asprv1 C T 6: 86,628,636 Q155* probably null Het
Atl1 A G 12: 69,926,188 Q94R probably benign Het
Atp2a2 A G 5: 122,457,377 L970P probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Bod1l A G 5: 41,816,429 M2514T probably benign Het
Cacfd1 T A 2: 27,018,939 D97E probably benign Het
Cacna1e A G 1: 154,561,758 L344P probably damaging Het
Cacna2d2 C A 9: 107,517,416 R596S probably damaging Het
Catip C A 1: 74,364,652 S176* probably null Het
Cdcp1 G A 9: 123,173,588 S806L probably damaging Het
Cdk6 A T 5: 3,520,675 I289L probably benign Het
Cers3 C T 7: 66,781,823 T182I probably damaging Het
Cfap46 T A 7: 139,683,008 N43I probably null Het
Clec4n A T 6: 123,230,033 R5S possibly damaging Het
Cnr2 G T 4: 135,916,701 S30I probably benign Het
Cpne6 T C 14: 55,515,220 V289A possibly damaging Het
Crym G A 7: 120,197,715 L141F probably benign Het
Cxxc5 T C 18: 35,858,569 S8P unknown Het
Dido1 A C 2: 180,684,970 S453R possibly damaging Het
Dnah2 A C 11: 69,477,202 S1770R probably benign Het
Dnah7a A G 1: 53,495,989 V2704A possibly damaging Het
Eml5 T C 12: 98,794,276 N1738S probably damaging Het
Eri3 A G 4: 117,582,639 T138A possibly damaging Het
Ext2 C T 2: 93,707,287 E585K probably damaging Het
Fam35a C G 14: 34,268,876 Q24H probably damaging Het
Fam84b A G 15: 60,823,649 C83R probably damaging Het
Fbxw19 T A 9: 109,494,988 S38C probably damaging Het
Fmo6 G A 1: 162,926,106 P156S probably damaging Het
Frem3 T C 8: 80,612,710 L544P probably damaging Het
Frem3 A T 8: 80,613,135 I686F probably benign Het
Gabra1 T C 11: 42,140,350 Y251C probably benign Het
Gemin4 G T 11: 76,211,161 Q925K probably benign Het
Gm18856 T A 13: 13,964,689 probably benign Het
Gnb1 A T 4: 155,551,714 T164S probably benign Het
Gpx6 A G 13: 21,313,652 D31G possibly damaging Het
Gzmd A C 14: 56,130,345 I157S probably benign Het
Il31ra T A 13: 112,547,466 N43I possibly damaging Het
Irak3 T C 10: 120,165,130 T297A probably benign Het
Kank2 T C 9: 21,774,631 D649G probably damaging Het
Kif3b AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 2: 153,317,462 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl18 A G 9: 110,446,747 F111S probably damaging Het
Lrp5 A G 19: 3,647,585 S319P possibly damaging Het
Marc1 T C 1: 184,802,002 E223G probably damaging Het
Mettl15 T C 2: 109,131,665 probably null Het
Ncoa1 T C 12: 4,270,748 Q1107R possibly damaging Het
Ncoa7 T G 10: 30,694,211 M251L probably damaging Het
Nos2 A T 11: 78,956,570 M1023L probably benign Het
Nup107 T C 10: 117,790,494 K25E probably damaging Het
Olfr1491 A T 19: 13,705,496 Y223F probably damaging Het
Olfr177 T A 16: 58,872,898 N84I probably damaging Het
Olfr482 T A 7: 108,095,286 I95F probably damaging Het
Olfr591 A G 7: 103,172,986 I217T probably damaging Het
Olfr711 A T 7: 106,971,983 Y120* probably null Het
Olfr776 T C 10: 129,261,213 I84T probably damaging Het
Parm1 G A 5: 91,594,447 E225K possibly damaging Het
Pdzd2 A C 15: 12,372,961 S2363A probably damaging Het
Piezo1 A G 8: 122,491,403 L1199P probably damaging Het
Prpsap1 A T 11: 116,479,708 M141K probably benign Het
Prss29 A T 17: 25,320,283 M1L possibly damaging Het
Pter T A 2: 12,978,606 S141T probably benign Het
Ptpru A T 4: 131,774,351 D1181E probably damaging Het
Rab3ip T A 10: 116,939,254 Q66H probably damaging Het
Rgs12 A T 5: 35,021,167 T779S probably damaging Het
Rgs22 A G 15: 36,048,776 F786S probably damaging Het
Rnasel A T 1: 153,760,794 D640V possibly damaging Het
Rp1 T C 1: 4,345,676 T1738A probably damaging Het
Sacs T C 14: 61,210,059 S3185P probably damaging Het
Scnn1a T A 6: 125,338,893 D321E possibly damaging Het
Sec31b G C 19: 44,518,586 L1014V probably benign Het
Serpinb10 A G 1: 107,540,960 Y111C probably damaging Het
Siglecg A G 7: 43,417,889 K627E possibly damaging Het
Sigmar1 T C 4: 41,740,845 I95V probably benign Het
Sirpb1b T A 3: 15,548,759 T88S possibly damaging Het
Spire2 T G 8: 123,358,156 L245R probably damaging Het
Stard9 C A 2: 120,696,711 P1150T probably benign Het
Stat6 C A 10: 127,653,256 T380N probably damaging Het
Sult3a1 G A 10: 33,870,170 G162E probably benign Het
Surf4 T C 2: 26,933,698 probably null Het
Tacc2 T C 7: 130,625,419 M1278T probably benign Het
Tacr2 T A 10: 62,261,327 probably null Het
Tcaf1 A T 6: 42,678,989 V351E probably damaging Het
Tmcc2 A G 1: 132,380,980 S59P probably damaging Het
Tmem17 G A 11: 22,517,266 S60N possibly damaging Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Tmprss7 A T 16: 45,679,390 I307N probably benign Het
Treml2 A T 17: 48,302,758 T73S possibly damaging Het
Trrap A G 5: 144,837,202 H2876R possibly damaging Het
Tyw3 A G 3: 154,596,869 I53T probably damaging Het
Ugp2 A G 11: 21,333,791 I92T possibly damaging Het
Vmn2r66 A T 7: 84,994,958 M748K possibly damaging Het
Vmn2r82 T C 10: 79,356,744 S52P possibly damaging Het
Wdr37 A T 13: 8,836,792 S320T probably benign Het
Zbtb16 A T 9: 48,832,283 M243K probably benign Het
Zfr C T 15: 12,150,243 T432I possibly damaging Het
Other mutations in Col18a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Col18a1 APN 10 77069979 missense possibly damaging 0.93
IGL01023:Col18a1 APN 10 77070975 missense probably damaging 0.98
IGL01304:Col18a1 APN 10 77076141 unclassified probably benign
IGL01519:Col18a1 APN 10 77059323 missense probably damaging 0.99
IGL02217:Col18a1 APN 10 77053298 missense probably damaging 0.96
IGL02275:Col18a1 APN 10 77059383 missense possibly damaging 0.92
IGL02283:Col18a1 APN 10 77113109 missense possibly damaging 0.71
IGL02492:Col18a1 APN 10 77072021 splice site probably benign
IGL02673:Col18a1 APN 10 77059163 missense probably damaging 1.00
IGL02710:Col18a1 APN 10 77113312 missense possibly damaging 0.92
IGL02850:Col18a1 APN 10 77096466 missense probably damaging 0.98
IGL03085:Col18a1 APN 10 77059181 splice site probably benign
IGL03102:Col18a1 APN 10 77067623 splice site probably benign
IGL03139:Col18a1 APN 10 77113343 missense possibly damaging 0.84
IGL03181:Col18a1 APN 10 77055698 missense probably damaging 1.00
IGL03183:Col18a1 APN 10 77073754 missense probably damaging 1.00
R0039:Col18a1 UTSW 10 77077168 missense probably damaging 1.00
R0180:Col18a1 UTSW 10 77096517 missense probably benign 0.33
R0225:Col18a1 UTSW 10 77088914 missense possibly damaging 0.90
R0335:Col18a1 UTSW 10 77059363 missense probably damaging 0.99
R0336:Col18a1 UTSW 10 77058736 missense probably damaging 1.00
R1471:Col18a1 UTSW 10 77096206 missense unknown
R1594:Col18a1 UTSW 10 77113036 missense possibly damaging 0.51
R1631:Col18a1 UTSW 10 77059297 missense probably damaging 0.99
R1774:Col18a1 UTSW 10 77059981 missense probably damaging 0.96
R1934:Col18a1 UTSW 10 77112744 missense possibly damaging 0.73
R1990:Col18a1 UTSW 10 77081154 missense unknown
R1991:Col18a1 UTSW 10 77081154 missense unknown
R1992:Col18a1 UTSW 10 77081154 missense unknown
R2081:Col18a1 UTSW 10 77054185 missense probably damaging 1.00
R2082:Col18a1 UTSW 10 77059293 missense probably damaging 1.00
R2351:Col18a1 UTSW 10 77112704 missense probably benign 0.00
R2510:Col18a1 UTSW 10 77096268 missense unknown
R3076:Col18a1 UTSW 10 77088928 missense possibly damaging 0.57
R3433:Col18a1 UTSW 10 77096268 missense unknown
R3800:Col18a1 UTSW 10 77067387 nonsense probably null
R3918:Col18a1 UTSW 10 77053358 missense probably benign 0.05
R3981:Col18a1 UTSW 10 77088887 missense probably damaging 0.99
R3983:Col18a1 UTSW 10 77088887 missense probably damaging 0.99
R4182:Col18a1 UTSW 10 77058841 splice site probably null
R4239:Col18a1 UTSW 10 77096167 missense unknown
R5014:Col18a1 UTSW 10 77070960 critical splice donor site probably null
R5107:Col18a1 UTSW 10 77077223 critical splice acceptor site probably null
R5413:Col18a1 UTSW 10 77069476 missense probably damaging 1.00
R5503:Col18a1 UTSW 10 77071620 missense probably damaging 1.00
R5524:Col18a1 UTSW 10 77058724 missense probably damaging 1.00
R5772:Col18a1 UTSW 10 77166343 missense unknown
R5958:Col18a1 UTSW 10 77096397 missense probably benign 0.01
R6280:Col18a1 UTSW 10 77112489 intron probably benign
R6309:Col18a1 UTSW 10 77112742 intron probably benign
R6603:Col18a1 UTSW 10 77063977 critical splice donor site probably null
R6608:Col18a1 UTSW 10 77112794 intron probably benign
R6805:Col18a1 UTSW 10 77054239 missense probably damaging 1.00
R6890:Col18a1 UTSW 10 77113484 intron probably benign
R6938:Col18a1 UTSW 10 77112499 intron probably benign
R7002:Col18a1 UTSW 10 77166343 missense unknown
R7154:Col18a1 UTSW 10 77072965 missense probably benign 0.25
R7204:Col18a1 UTSW 10 77085276 missense unknown
R7278:Col18a1 UTSW 10 77096284 missense unknown
R7442:Col18a1 UTSW 10 77096238 missense unknown
Predicted Primers PCR Primer
(F):5'- CATTTCAGTTACTCGCCAGGACCC -3'
(R):5'- CCTTGCAGAGCCAAGTCTAGTCAG -3'

Sequencing Primer
(F):5'- AAGCTGAGAGCTATCCCCTG -3'
(R):5'- CCAAGTCTAGTCAGGGATTTGAATG -3'
Posted On2014-04-13