Incidental Mutation 'R1549:Lime1'
ID169768
Institutional Source Beutler Lab
Gene Symbol Lime1
Ensembl Gene ENSMUSG00000090077
Gene NameLck interacting transmembrane adaptor 1
SynonymsLIME, 2810038K19Rik
MMRRC Submission 039588-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1549 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181380078-181383628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181383376 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 242 (Y242C)
Ref Sequence ENSEMBL: ENSMUSP00000045010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029105] [ENSMUST00000029106] [ENSMUST00000048077] [ENSMUST00000108804] [ENSMUST00000108807] [ENSMUST00000116366]
Predicted Effect probably benign
Transcript: ENSMUST00000029105
SMART Domains Protein: ENSMUSP00000029105
Gene: ENSMUSG00000027582

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
ZnF_C3H1 174 199 5.99e-4 SMART
SCOP:d1g5va_ 218 268 2e-3 SMART
low complexity region 270 287 N/A INTRINSIC
G_patch 311 357 1.34e-9 SMART
low complexity region 379 392 N/A INTRINSIC
coiled coil region 431 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029106
SMART Domains Protein: ENSMUSP00000029106
Gene: ENSMUSG00000027583

DomainStartEndE-ValueType
BTB 31 129 2.89e-21 SMART
ZnF_C2H2 418 440 4.72e-2 SMART
ZnF_C2H2 446 468 4.24e-4 SMART
ZnF_C2H2 474 498 1.31e2 SMART
low complexity region 543 557 N/A INTRINSIC
low complexity region 568 580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048077
AA Change: Y242C

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000045010
Gene: ENSMUSG00000090077
AA Change: Y242C

DomainStartEndE-ValueType
Pfam:LIME1 27 266 5.6e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108804
SMART Domains Protein: ENSMUSP00000104432
Gene: ENSMUSG00000090077

DomainStartEndE-ValueType
Pfam:LIME1 27 87 9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108807
SMART Domains Protein: ENSMUSP00000104435
Gene: ENSMUSG00000027582

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
ZnF_C3H1 174 199 5.99e-4 SMART
SCOP:d1g5va_ 218 268 2e-3 SMART
low complexity region 270 287 N/A INTRINSIC
G_patch 311 357 1.34e-9 SMART
low complexity region 379 392 N/A INTRINSIC
coiled coil region 431 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116366
SMART Domains Protein: ENSMUSP00000112067
Gene: ENSMUSG00000027582

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
ZnF_C3H1 174 199 5.99e-4 SMART
SCOP:d1g5va_ 218 268 2e-3 SMART
low complexity region 270 287 N/A INTRINSIC
G_patch 311 357 1.34e-9 SMART
low complexity region 379 392 N/A INTRINSIC
coiled coil region 431 505 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000126611
AA Change: Y221C
SMART Domains Protein: ENSMUSP00000119181
Gene: ENSMUSG00000090077
AA Change: Y221C

DomainStartEndE-ValueType
Pfam:LIME1 4 246 9.6e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131284
Predicted Effect probably benign
Transcript: ENSMUST00000140943
SMART Domains Protein: ENSMUSP00000117558
Gene: ENSMUSG00000090077

DomainStartEndE-ValueType
Pfam:LIME1 24 189 5.4e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151457
Predicted Effect probably benign
Transcript: ENSMUST00000156258
SMART Domains Protein: ENSMUSP00000122714
Gene: ENSMUSG00000027582

DomainStartEndE-ValueType
G_patch 1 44 1.18e-5 SMART
low complexity region 66 79 N/A INTRINSIC
coiled coil region 117 148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184328
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane adaptor protein that links the T and B-cell receptor stimulation to downstream signaling pathways via its association with the Src family kinases Lck and Lyn, respectively. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a targeted null allele exhibit no detectable abnormalities in the development and function of B and T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,792 I157K probably benign Het
Ank3 A T 10: 70,001,982 N727Y probably benign Het
Atg16l1 A G 1: 87,774,188 T251A probably benign Het
Bcl11b T A 12: 107,917,163 I226F probably damaging Het
Birc6 A G 17: 74,662,742 H4260R probably damaging Het
Camta1 A G 4: 151,586,463 I85T probably damaging Het
Cblb A G 16: 52,033,010 probably benign Het
Ccnd1 T G 7: 144,937,336 I178L probably benign Het
Clcn4 A G 7: 7,291,682 V329A probably damaging Het
Col17a1 C T 19: 47,648,910 probably benign Het
Col7a1 A G 9: 108,955,966 T254A unknown Het
Ctif C A 18: 75,565,025 R188L probably damaging Het
Cyp2c69 A T 19: 39,842,986 L461Q probably benign Het
Ddc A G 11: 11,846,656 probably null Het
Dpp10 T A 1: 123,341,380 probably null Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Eif2b4 T C 5: 31,192,921 E19G possibly damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galnt14 A G 17: 73,525,313 L269P possibly damaging Het
Gm14409 T C 2: 177,265,585 E40G probably damaging Het
Gm2381 T A 7: 42,822,401 H18L probably benign Het
Gpbp1 G T 13: 111,436,579 D326E probably benign Het
Gpr162 C T 6: 124,860,088 R331H probably damaging Het
Iigp1 G A 18: 60,389,876 G22D probably benign Het
Kcns3 T C 12: 11,092,083 H205R probably damaging Het
Klk1b26 C T 7: 44,016,402 probably benign Het
Manba A G 3: 135,544,806 D398G probably damaging Het
Mapk3 A T 7: 126,763,512 K219* probably null Het
Mdfic G T 6: 15,799,845 G324C probably damaging Het
Mdga1 G A 17: 29,837,998 H837Y probably damaging Het
Nck1 T A 9: 100,497,872 M109L probably benign Het
Olfr1369-ps1 T C 13: 21,116,118 V142A probably benign Het
Olfr412 A G 11: 74,365,250 I194V probably benign Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Phf3 C T 1: 30,804,842 V1679I probably benign Het
Pou4f1 T C 14: 104,467,640 I32V probably benign Het
Pspc1 T G 14: 56,748,941 H351P probably damaging Het
Ptk7 T C 17: 46,572,652 E829G probably damaging Het
Rab23 A G 1: 33,738,297 Y164C possibly damaging Het
Slc36a3 A G 11: 55,142,770 W141R probably damaging Het
Slc7a14 T C 3: 31,224,118 E446G possibly damaging Het
Stim2 G A 5: 54,105,325 R303Q probably damaging Het
Tbcd A G 11: 121,560,753 I550V probably benign Het
Tmed3 A C 9: 89,699,945 L155R probably damaging Het
Trav16d-dv11 A G 14: 53,047,342 probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Usp16 G T 16: 87,464,834 V113F probably damaging Het
Vmn2r12 T G 5: 109,092,830 Y139S probably benign Het
Vmn2r5 G T 3: 64,504,000 D382E probably damaging Het
Zfp217 A C 2: 170,114,470 N869K probably benign Het
Zswim2 G T 2: 83,923,748 D189E probably benign Het
Other mutations in Lime1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01873:Lime1 APN 2 181382874 missense probably benign 0.00
R1782:Lime1 UTSW 2 181383056 missense possibly damaging 0.95
R5225:Lime1 UTSW 2 181382847 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGAATATGCCTGCATCCAGAAGCAC -3'
(R):5'- CCTGAAGCAGAAGCCTTGGTACTC -3'

Sequencing Primer
(F):5'- TAAGGTGATCCCAGCTACTCAGG -3'
(R):5'- AGAAGCCTTGGTACTCTTCCTAAC -3'
Posted On2014-04-13