Incidental Mutation 'R1549:1700006A11Rik'
List |< first << previous [record 64 of 55675] next >> last >|
ID169771
Institutional Source Beutler Lab
Gene Symbol 1700006A11Rik
Ensembl Gene ENSMUSG00000027973
Gene NameRIKEN cDNA 1700006A11 gene
Synonyms
MMRRC Submission 039588-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1549 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location124400989-124426040 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124416792 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 157 (I157K)
Ref Sequence ENSEMBL: ENSMUSP00000029598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029598] [ENSMUST00000198630]
Predicted Effect probably benign
Transcript: ENSMUST00000029598
AA Change: I157K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000029598
Gene: ENSMUSG00000027973
AA Change: I157K

DomainStartEndE-ValueType
RhoGAP 78 251 3.63e-37 SMART
RhoGAP 377 543 3.19e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197975
Predicted Effect probably benign
Transcript: ENSMUST00000198630
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 A T 10: 70,001,982 N727Y probably benign Het
Atg16l1 A G 1: 87,774,188 T251A probably benign Het
Bcl11b T A 12: 107,917,163 I226F probably damaging Het
Birc6 A G 17: 74,662,742 H4260R probably damaging Het
Camta1 A G 4: 151,586,463 I85T probably damaging Het
Cblb A G 16: 52,033,010 probably benign Het
Ccnd1 T G 7: 144,937,336 I178L probably benign Het
Clcn4 A G 7: 7,291,682 V329A probably damaging Het
Col17a1 C T 19: 47,648,910 probably benign Het
Col7a1 A G 9: 108,955,966 T254A unknown Het
Ctif C A 18: 75,565,025 R188L probably damaging Het
Cyp2c69 A T 19: 39,842,986 L461Q probably benign Het
Ddc A G 11: 11,846,656 probably null Het
Dpp10 T A 1: 123,341,380 probably null Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Eif2b4 T C 5: 31,192,921 E19G possibly damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galnt14 A G 17: 73,525,313 L269P possibly damaging Het
Gm14409 T C 2: 177,265,585 E40G probably damaging Het
Gm2381 T A 7: 42,822,401 H18L probably benign Het
Gpbp1 G T 13: 111,436,579 D326E probably benign Het
Gpr162 C T 6: 124,860,088 R331H probably damaging Het
Iigp1 G A 18: 60,389,876 G22D probably benign Het
Kcns3 T C 12: 11,092,083 H205R probably damaging Het
Klk1b26 C T 7: 44,016,402 probably benign Het
Lime1 A G 2: 181,383,376 Y242C probably benign Het
Manba A G 3: 135,544,806 D398G probably damaging Het
Mapk3 A T 7: 126,763,512 K219* probably null Het
Mdfic G T 6: 15,799,845 G324C probably damaging Het
Mdga1 G A 17: 29,837,998 H837Y probably damaging Het
Nck1 T A 9: 100,497,872 M109L probably benign Het
Olfr1369-ps1 T C 13: 21,116,118 V142A probably benign Het
Olfr412 A G 11: 74,365,250 I194V probably benign Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Phf3 C T 1: 30,804,842 V1679I probably benign Het
Pou4f1 T C 14: 104,467,640 I32V probably benign Het
Pspc1 T G 14: 56,748,941 H351P probably damaging Het
Ptk7 T C 17: 46,572,652 E829G probably damaging Het
Rab23 A G 1: 33,738,297 Y164C possibly damaging Het
Slc36a3 A G 11: 55,142,770 W141R probably damaging Het
Slc7a14 T C 3: 31,224,118 E446G possibly damaging Het
Stim2 G A 5: 54,105,325 R303Q probably damaging Het
Tbcd A G 11: 121,560,753 I550V probably benign Het
Tmed3 A C 9: 89,699,945 L155R probably damaging Het
Trav16d-dv11 A G 14: 53,047,342 probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Usp16 G T 16: 87,464,834 V113F probably damaging Het
Vmn2r12 T G 5: 109,092,830 Y139S probably benign Het
Vmn2r5 G T 3: 64,504,000 D382E probably damaging Het
Zfp217 A C 2: 170,114,470 N869K probably benign Het
Zswim2 G T 2: 83,923,748 D189E probably benign Het
Other mutations in 1700006A11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:1700006A11Rik APN 3 124401409 missense probably benign 0.30
IGL02552:1700006A11Rik APN 3 124414496 missense probably damaging 1.00
IGL03092:1700006A11Rik APN 3 124406470 missense probably damaging 1.00
R0094:1700006A11Rik UTSW 3 124409778 splice site probably benign
R0097:1700006A11Rik UTSW 3 124412480 missense probably benign 0.13
R0097:1700006A11Rik UTSW 3 124412480 missense probably benign 0.13
R0184:1700006A11Rik UTSW 3 124419250 missense probably damaging 1.00
R0361:1700006A11Rik UTSW 3 124413634 missense possibly damaging 0.69
R1542:1700006A11Rik UTSW 3 124414406 missense possibly damaging 0.95
R1779:1700006A11Rik UTSW 3 124406514 missense probably damaging 0.99
R1839:1700006A11Rik UTSW 3 124409720 missense probably damaging 0.99
R1986:1700006A11Rik UTSW 3 124419328 missense probably damaging 0.99
R2042:1700006A11Rik UTSW 3 124416728 splice site probably benign
R2149:1700006A11Rik UTSW 3 124409686 missense probably benign 0.33
R2258:1700006A11Rik UTSW 3 124413618 missense possibly damaging 0.84
R2291:1700006A11Rik UTSW 3 124413801 missense probably damaging 1.00
R2509:1700006A11Rik UTSW 3 124406453 missense probably benign 0.44
R4912:1700006A11Rik UTSW 3 124419856 missense possibly damaging 0.68
R5074:1700006A11Rik UTSW 3 124416833 missense probably benign 0.01
R5303:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5307:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5308:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5796:1700006A11Rik UTSW 3 124421428 missense possibly damaging 0.66
R6018:1700006A11Rik UTSW 3 124416799 missense probably damaging 1.00
R6198:1700006A11Rik UTSW 3 124416850 splice site probably null
R6504:1700006A11Rik UTSW 3 124419920 missense probably benign
X0063:1700006A11Rik UTSW 3 124419862 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACCTAAGCTAACCCCAAGTTACTGG -3'
(R):5'- CCTGTGAAGGAAGTTGGGACTAAACTG -3'

Sequencing Primer
(F):5'- TTGTGACTGCTGAAAGAAAGAAATC -3'
(R):5'- GAAGTTGGGACTAAACTGAATTTTAC -3'
Posted On2014-04-13