Incidental Mutation 'R1549:Nck1'
ID169788
Institutional Source Beutler Lab
Gene Symbol Nck1
Ensembl Gene ENSMUSG00000032475
Gene Namenon-catalytic region of tyrosine kinase adaptor protein 1
SynonymsD230010O13Rik, 6330586M15Rik, Nck
MMRRC Submission 039588-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1549 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location100492293-100546134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100497872 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 109 (M109L)
Ref Sequence ENSEMBL: ENSMUSP00000140143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112874] [ENSMUST00000116522] [ENSMUST00000186591] [ENSMUST00000188670]
Predicted Effect probably benign
Transcript: ENSMUST00000112874
AA Change: M45L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108495
Gene: ENSMUSG00000032475
AA Change: M45L

DomainStartEndE-ValueType
SH3 45 100 3.58e-18 SMART
SH3 129 187 2.65e-21 SMART
SH2 216 298 1.6e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116522
AA Change: M109L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112221
Gene: ENSMUSG00000032475
AA Change: M109L

DomainStartEndE-ValueType
SH3 5 60 3.99e-16 SMART
SH3 109 164 3.58e-18 SMART
SH3 193 251 2.65e-21 SMART
SH2 280 362 1.6e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186591
AA Change: M109L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140971
Gene: ENSMUSG00000032475
AA Change: M109L

DomainStartEndE-ValueType
SH3 5 60 2.5e-18 SMART
SH3 109 164 2.2e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188670
AA Change: M109L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140143
Gene: ENSMUSG00000032475
AA Change: M109L

DomainStartEndE-ValueType
SH3 5 60 2.5e-18 SMART
PDB:2CUB|A 99 132 2e-17 PDB
Blast:SH3 109 132 2e-8 BLAST
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the signaling and transforming proteins containing Src homology 2 and 3 (SH2 and SH3) domains. It is located in the cytoplasm and is an adaptor protein involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as RAS. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for disruption of this gene display no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,792 I157K probably benign Het
Ank3 A T 10: 70,001,982 N727Y probably benign Het
Atg16l1 A G 1: 87,774,188 T251A probably benign Het
Bcl11b T A 12: 107,917,163 I226F probably damaging Het
Birc6 A G 17: 74,662,742 H4260R probably damaging Het
Camta1 A G 4: 151,586,463 I85T probably damaging Het
Cblb A G 16: 52,033,010 probably benign Het
Ccnd1 T G 7: 144,937,336 I178L probably benign Het
Clcn4 A G 7: 7,291,682 V329A probably damaging Het
Col17a1 C T 19: 47,648,910 probably benign Het
Col7a1 A G 9: 108,955,966 T254A unknown Het
Ctif C A 18: 75,565,025 R188L probably damaging Het
Cyp2c69 A T 19: 39,842,986 L461Q probably benign Het
Ddc A G 11: 11,846,656 probably null Het
Dpp10 T A 1: 123,341,380 probably null Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Eif2b4 T C 5: 31,192,921 E19G possibly damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galnt14 A G 17: 73,525,313 L269P possibly damaging Het
Gm14409 T C 2: 177,265,585 E40G probably damaging Het
Gm2381 T A 7: 42,822,401 H18L probably benign Het
Gpbp1 G T 13: 111,436,579 D326E probably benign Het
Gpr162 C T 6: 124,860,088 R331H probably damaging Het
Iigp1 G A 18: 60,389,876 G22D probably benign Het
Kcns3 T C 12: 11,092,083 H205R probably damaging Het
Klk1b26 C T 7: 44,016,402 probably benign Het
Lime1 A G 2: 181,383,376 Y242C probably benign Het
Manba A G 3: 135,544,806 D398G probably damaging Het
Mapk3 A T 7: 126,763,512 K219* probably null Het
Mdfic G T 6: 15,799,845 G324C probably damaging Het
Mdga1 G A 17: 29,837,998 H837Y probably damaging Het
Olfr1369-ps1 T C 13: 21,116,118 V142A probably benign Het
Olfr412 A G 11: 74,365,250 I194V probably benign Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Phf3 C T 1: 30,804,842 V1679I probably benign Het
Pou4f1 T C 14: 104,467,640 I32V probably benign Het
Pspc1 T G 14: 56,748,941 H351P probably damaging Het
Ptk7 T C 17: 46,572,652 E829G probably damaging Het
Rab23 A G 1: 33,738,297 Y164C possibly damaging Het
Slc36a3 A G 11: 55,142,770 W141R probably damaging Het
Slc7a14 T C 3: 31,224,118 E446G possibly damaging Het
Stim2 G A 5: 54,105,325 R303Q probably damaging Het
Tbcd A G 11: 121,560,753 I550V probably benign Het
Tmed3 A C 9: 89,699,945 L155R probably damaging Het
Trav16d-dv11 A G 14: 53,047,342 probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Usp16 G T 16: 87,464,834 V113F probably damaging Het
Vmn2r12 T G 5: 109,092,830 Y139S probably benign Het
Vmn2r5 G T 3: 64,504,000 D382E probably damaging Het
Zfp217 A C 2: 170,114,470 N869K probably benign Het
Zswim2 G T 2: 83,923,748 D189E probably benign Het
Other mutations in Nck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Nck1 APN 9 100497737 missense probably damaging 1.00
IGL01608:Nck1 APN 9 100497387 missense probably benign
IGL02711:Nck1 APN 9 100508620 missense probably damaging 1.00
R0211:Nck1 UTSW 9 100497767 missense probably damaging 1.00
R0211:Nck1 UTSW 9 100497767 missense probably damaging 1.00
R2128:Nck1 UTSW 9 100497547 unclassified probably null
R2314:Nck1 UTSW 9 100497950 missense probably damaging 1.00
R4744:Nck1 UTSW 9 100506744 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGACAACTGCTGCTAATTTCTCTGACA -3'
(R):5'- ACACGAGAAAATTCAACATGGCAACTTT -3'

Sequencing Primer
(F):5'- TGATCACCCAAAGGACTGTC -3'
(R):5'- TTGGCTTGGTTATGGAAGAACAAC -3'
Posted On2014-04-13