Incidental Mutation 'R1549:Bcl11b'
ID169797
Institutional Source Beutler Lab
Gene Symbol Bcl11b
Ensembl Gene ENSMUSG00000048251
Gene NameB cell leukemia/lymphoma 11B
Synonyms9130430L19Rik, CTIP2, B630002E05Rik, COUP-TF interacting protein 2, Rit1
MMRRC Submission 039588-MU
Accession Numbers

Genbank: NM_001079883; MGI: 1929913

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1549 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location107910403-108003602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107917163 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 226 (I226F)
Ref Sequence ENSEMBL: ENSMUSP00000105517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066060] [ENSMUST00000109887] [ENSMUST00000109891]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066060
AA Change: I298F

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000068258
Gene: ENSMUSG00000048251
AA Change: I298F

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
Blast:ZnF_C2H2 56 81 5e-10 BLAST
low complexity region 95 113 N/A INTRINSIC
ZnF_C2H2 221 244 1.16e-1 SMART
low complexity region 311 330 N/A INTRINSIC
ZnF_C2H2 426 448 6.23e-2 SMART
ZnF_C2H2 454 476 2.75e-3 SMART
low complexity region 519 551 N/A INTRINSIC
low complexity region 566 593 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 639 656 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 743 765 N/A INTRINSIC
ZnF_C2H2 786 808 1.41e0 SMART
ZnF_C2H2 814 836 4.24e-4 SMART
ZnF_C2H2 844 867 3.07e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109887
AA Change: I104F

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105513
Gene: ENSMUSG00000048251
AA Change: I104F

DomainStartEndE-ValueType
ZnF_C2H2 27 50 1.16e-1 SMART
low complexity region 117 136 N/A INTRINSIC
ZnF_C2H2 232 254 6.23e-2 SMART
ZnF_C2H2 260 282 2.75e-3 SMART
low complexity region 325 357 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
low complexity region 423 442 N/A INTRINSIC
low complexity region 445 462 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
low complexity region 549 571 N/A INTRINSIC
ZnF_C2H2 592 614 1.41e0 SMART
ZnF_C2H2 620 642 4.24e-4 SMART
ZnF_C2H2 650 673 3.07e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109891
AA Change: I226F

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105517
Gene: ENSMUSG00000048251
AA Change: I226F

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
Pfam:zf-C2H2_6 55 83 3.9e-9 PFAM
low complexity region 95 113 N/A INTRINSIC
ZnF_C2H2 149 172 1.16e-1 SMART
low complexity region 239 258 N/A INTRINSIC
ZnF_C2H2 354 376 6.23e-2 SMART
ZnF_C2H2 382 404 2.75e-3 SMART
low complexity region 447 479 N/A INTRINSIC
low complexity region 494 521 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 567 584 N/A INTRINSIC
low complexity region 587 603 N/A INTRINSIC
low complexity region 671 693 N/A INTRINSIC
ZnF_C2H2 714 736 1.41e0 SMART
ZnF_C2H2 742 764 4.24e-4 SMART
ZnF_C2H2 772 795 3.07e-1 SMART
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger protein and is closely related to BCL11A, a gene whose translocation may be associated with B-cell malignancies. Although the specific function of this gene has not been determined, the encoded protein is known to be a transcriptional repressor, and is regulated by the NURD nucleosome remodeling and histone deacetylase complex. Four alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Animals homozygous for a mutation of this gene are born with open eyes, exhibit abnormalities of the thymus, and die within 1 day after birth. Mice heterozygous for a hypomorphic allele and a knock-out allele exhibit lethality at weaning due to maxillaryincisor hyperplasia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,792 I157K probably benign Het
Ank3 A T 10: 70,001,982 N727Y probably benign Het
Atg16l1 A G 1: 87,774,188 T251A probably benign Het
Birc6 A G 17: 74,662,742 H4260R probably damaging Het
Camta1 A G 4: 151,586,463 I85T probably damaging Het
Cblb A G 16: 52,033,010 probably benign Het
Ccnd1 T G 7: 144,937,336 I178L probably benign Het
Clcn4 A G 7: 7,291,682 V329A probably damaging Het
Col17a1 C T 19: 47,648,910 probably benign Het
Col7a1 A G 9: 108,955,966 T254A unknown Het
Ctif C A 18: 75,565,025 R188L probably damaging Het
Cyp2c69 A T 19: 39,842,986 L461Q probably benign Het
Ddc A G 11: 11,846,656 probably null Het
Dpp10 T A 1: 123,341,380 probably null Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Eif2b4 T C 5: 31,192,921 E19G possibly damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galnt14 A G 17: 73,525,313 L269P possibly damaging Het
Gm14409 T C 2: 177,265,585 E40G probably damaging Het
Gm2381 T A 7: 42,822,401 H18L probably benign Het
Gpbp1 G T 13: 111,436,579 D326E probably benign Het
Gpr162 C T 6: 124,860,088 R331H probably damaging Het
Iigp1 G A 18: 60,389,876 G22D probably benign Het
Kcns3 T C 12: 11,092,083 H205R probably damaging Het
Klk1b26 C T 7: 44,016,402 probably benign Het
Lime1 A G 2: 181,383,376 Y242C probably benign Het
Manba A G 3: 135,544,806 D398G probably damaging Het
Mapk3 A T 7: 126,763,512 K219* probably null Het
Mdfic G T 6: 15,799,845 G324C probably damaging Het
Mdga1 G A 17: 29,837,998 H837Y probably damaging Het
Nck1 T A 9: 100,497,872 M109L probably benign Het
Olfr1369-ps1 T C 13: 21,116,118 V142A probably benign Het
Olfr412 A G 11: 74,365,250 I194V probably benign Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Phf3 C T 1: 30,804,842 V1679I probably benign Het
Pou4f1 T C 14: 104,467,640 I32V probably benign Het
Pspc1 T G 14: 56,748,941 H351P probably damaging Het
Ptk7 T C 17: 46,572,652 E829G probably damaging Het
Rab23 A G 1: 33,738,297 Y164C possibly damaging Het
Slc36a3 A G 11: 55,142,770 W141R probably damaging Het
Slc7a14 T C 3: 31,224,118 E446G possibly damaging Het
Stim2 G A 5: 54,105,325 R303Q probably damaging Het
Tbcd A G 11: 121,560,753 I550V probably benign Het
Tmed3 A C 9: 89,699,945 L155R probably damaging Het
Trav16d-dv11 A G 14: 53,047,342 probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Usp16 G T 16: 87,464,834 V113F probably damaging Het
Vmn2r12 T G 5: 109,092,830 Y139S probably benign Het
Vmn2r5 G T 3: 64,504,000 D382E probably damaging Het
Zfp217 A C 2: 170,114,470 N869K probably benign Het
Zswim2 G T 2: 83,923,748 D189E probably benign Het
Other mutations in Bcl11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Bcl11b APN 12 107965815 missense possibly damaging 0.46
IGL02492:Bcl11b APN 12 107915686 missense probably damaging 0.98
IGL02559:Bcl11b APN 12 107915394 utr 3 prime probably benign
IGL02950:Bcl11b APN 12 107989806 missense probably benign 0.00
R0055:Bcl11b UTSW 12 107965777 missense probably benign 0.02
R0762:Bcl11b UTSW 12 107965663 intron probably benign
R1682:Bcl11b UTSW 12 107916649 missense probably damaging 1.00
R2269:Bcl11b UTSW 12 107915651 missense possibly damaging 0.71
R2495:Bcl11b UTSW 12 107915447 missense possibly damaging 0.46
R3053:Bcl11b UTSW 12 107916001 missense probably benign 0.01
R4094:Bcl11b UTSW 12 107916835 missense probably damaging 1.00
R4095:Bcl11b UTSW 12 107916835 missense probably damaging 1.00
R4155:Bcl11b UTSW 12 107917425 splice site probably null
R4156:Bcl11b UTSW 12 107917425 splice site probably null
R4157:Bcl11b UTSW 12 107917425 splice site probably null
R4611:Bcl11b UTSW 12 107916530 missense probably damaging 0.97
R4900:Bcl11b UTSW 12 107989698 missense probably damaging 1.00
R4906:Bcl11b UTSW 12 107916709 missense probably damaging 1.00
R4982:Bcl11b UTSW 12 107965772 nonsense probably null
R5108:Bcl11b UTSW 12 107965726 missense probably benign 0.04
R5190:Bcl11b UTSW 12 107989716 missense probably damaging 1.00
R6380:Bcl11b UTSW 12 108003101 missense probably benign 0.20
R6423:Bcl11b UTSW 12 107915419 missense possibly damaging 0.82
R6792:Bcl11b UTSW 12 107989734 missense probably damaging 1.00
R7026:Bcl11b UTSW 12 107916592 missense probably damaging 0.99
R7074:Bcl11b UTSW 12 107989507 missense probably benign 0.01
X0018:Bcl11b UTSW 12 107989689 missense probably damaging 1.00
X0021:Bcl11b UTSW 12 107916877 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCACGATGAGATTGCTCTGGAAC -3'
(R):5'- CACACATGGCTTCCGAATCTACCTG -3'

Sequencing Primer
(F):5'- AACTCACAGGACTTGCTCTTGG -3'
(R):5'- CGAATCTACCTGGAGCCTG -3'
Posted On2014-04-13