Incidental Mutation 'R1549:Olfr1369-ps1'
ID169798
Institutional Source Beutler Lab
Gene Symbol Olfr1369-ps1
Ensembl Gene ENSMUSG00000060404
Gene Nameolfactory receptor 1369, pseudogene 1
SynonymsGA_x6K02T2QHY8-12126170-12125935, MOR256-31
MMRRC Submission 039588-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R1549 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location21111483-21119095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21116118 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 142 (V142A)
Ref Sequence ENSEMBL: ENSMUSP00000151041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079050] [ENSMUST00000213326] [ENSMUST00000213922] [ENSMUST00000215207] [ENSMUST00000215941]
Predicted Effect probably benign
Transcript: ENSMUST00000079050
AA Change: V142A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000078059
Gene: ENSMUSG00000060404
AA Change: V142A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.2e-47 PFAM
Pfam:7tm_1 41 290 1.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213326
AA Change: V142A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000213922
AA Change: V142A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000215207
AA Change: V142A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000215941
AA Change: V142A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.1524 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,792 I157K probably benign Het
Ank3 A T 10: 70,001,982 N727Y probably benign Het
Atg16l1 A G 1: 87,774,188 T251A probably benign Het
Bcl11b T A 12: 107,917,163 I226F probably damaging Het
Birc6 A G 17: 74,662,742 H4260R probably damaging Het
Camta1 A G 4: 151,586,463 I85T probably damaging Het
Cblb A G 16: 52,033,010 probably benign Het
Ccnd1 T G 7: 144,937,336 I178L probably benign Het
Clcn4 A G 7: 7,291,682 V329A probably damaging Het
Col17a1 C T 19: 47,648,910 probably benign Het
Col7a1 A G 9: 108,955,966 T254A unknown Het
Ctif C A 18: 75,565,025 R188L probably damaging Het
Cyp2c69 A T 19: 39,842,986 L461Q probably benign Het
Ddc A G 11: 11,846,656 probably null Het
Dpp10 T A 1: 123,341,380 probably null Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Eif2b4 T C 5: 31,192,921 E19G possibly damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galnt14 A G 17: 73,525,313 L269P possibly damaging Het
Gm14409 T C 2: 177,265,585 E40G probably damaging Het
Gm2381 T A 7: 42,822,401 H18L probably benign Het
Gpbp1 G T 13: 111,436,579 D326E probably benign Het
Gpr162 C T 6: 124,860,088 R331H probably damaging Het
Iigp1 G A 18: 60,389,876 G22D probably benign Het
Kcns3 T C 12: 11,092,083 H205R probably damaging Het
Klk1b26 C T 7: 44,016,402 probably benign Het
Lime1 A G 2: 181,383,376 Y242C probably benign Het
Manba A G 3: 135,544,806 D398G probably damaging Het
Mapk3 A T 7: 126,763,512 K219* probably null Het
Mdfic G T 6: 15,799,845 G324C probably damaging Het
Mdga1 G A 17: 29,837,998 H837Y probably damaging Het
Nck1 T A 9: 100,497,872 M109L probably benign Het
Olfr412 A G 11: 74,365,250 I194V probably benign Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Phf3 C T 1: 30,804,842 V1679I probably benign Het
Pou4f1 T C 14: 104,467,640 I32V probably benign Het
Pspc1 T G 14: 56,748,941 H351P probably damaging Het
Ptk7 T C 17: 46,572,652 E829G probably damaging Het
Rab23 A G 1: 33,738,297 Y164C possibly damaging Het
Slc36a3 A G 11: 55,142,770 W141R probably damaging Het
Slc7a14 T C 3: 31,224,118 E446G possibly damaging Het
Stim2 G A 5: 54,105,325 R303Q probably damaging Het
Tbcd A G 11: 121,560,753 I550V probably benign Het
Tmed3 A C 9: 89,699,945 L155R probably damaging Het
Trav16d-dv11 A G 14: 53,047,342 probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Usp16 G T 16: 87,464,834 V113F probably damaging Het
Vmn2r12 T G 5: 109,092,830 Y139S probably benign Het
Vmn2r5 G T 3: 64,504,000 D382E probably damaging Het
Zfp217 A C 2: 170,114,470 N869K probably benign Het
Zswim2 G T 2: 83,923,748 D189E probably benign Het
Other mutations in Olfr1369-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01689:Olfr1369-ps1 APN 13 21116073 missense probably damaging 0.97
R0631:Olfr1369-ps1 UTSW 13 21115908 missense probably damaging 1.00
R0960:Olfr1369-ps1 UTSW 13 21116265 missense possibly damaging 0.94
R1499:Olfr1369-ps1 UTSW 13 21116133 missense probably benign 0.32
R1698:Olfr1369-ps1 UTSW 13 21116565 missense probably benign 0.11
R1711:Olfr1369-ps1 UTSW 13 21116306 missense probably benign 0.01
R2404:Olfr1369-ps1 UTSW 13 21115842 missense probably damaging 1.00
R2471:Olfr1369-ps1 UTSW 13 21116429 missense probably damaging 1.00
R3844:Olfr1369-ps1 UTSW 13 21116063 missense possibly damaging 0.91
R3977:Olfr1369-ps1 UTSW 13 21115861 missense probably benign 0.03
R3979:Olfr1369-ps1 UTSW 13 21115861 missense probably benign 0.03
R4804:Olfr1369-ps1 UTSW 13 21116005 nonsense probably null
R4914:Olfr1369-ps1 UTSW 13 21116397 missense probably benign 0.12
R5210:Olfr1369-ps1 UTSW 13 21116052 missense probably damaging 0.99
R5359:Olfr1369-ps1 UTSW 13 21116267 missense probably damaging 1.00
R5700:Olfr1369-ps1 UTSW 13 21116001 missense probably damaging 1.00
R6218:Olfr1369-ps1 UTSW 13 21116231 missense probably damaging 1.00
R6767:Olfr1369-ps1 UTSW 13 21116057 missense probably benign 0.02
V8831:Olfr1369-ps1 UTSW 13 21116003 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGACCCGAAAAGACCATTAGCTCTG -3'
(R):5'- CTGCCTTTGACTTCATGTTGAGCAC -3'

Sequencing Primer
(F):5'- CATTAGCTCTGTGGGCTGTATTG -3'
(R):5'- ACTTCATGTTGAGCACAGTTTTG -3'
Posted On2014-04-13