Incidental Mutation 'R1549:Ptk7'
ID169806
Institutional Source Beutler Lab
Gene Symbol Ptk7
Ensembl Gene ENSMUSG00000023972
Gene NamePTK7 protein tyrosine kinase 7
Synonyms8430404F20Rik, mPTK7/CCK4, chz
MMRRC Submission 039588-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1549 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46564451-46629504 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46572652 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 829 (E829G)
Ref Sequence ENSEMBL: ENSMUSP00000043703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044442]
Predicted Effect probably damaging
Transcript: ENSMUST00000044442
AA Change: E829G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972
AA Change: E829G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 36 100 1.48e-6 SMART
IGc2 133 199 8.12e-13 SMART
IGc2 229 300 5.01e-4 SMART
IGc2 326 390 1.96e-6 SMART
IG 410 491 6.02e-7 SMART
IGc2 507 569 1.19e-10 SMART
IGc2 596 663 2.6e-11 SMART
transmembrane domain 696 718 N/A INTRINSIC
TyrKc 788 1053 4.34e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Meta Mutation Damage Score 0.286 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine kinase family of proteins that transduce extracellular signals across the cell membrane. The encoded protein lacks detectable catalytic tyrosine kinase activity, is involved in the Wnt signaling pathway and plays a role in multiple cellular processes including polarity and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally with defects in neural tube closure and planar cell polarity in the ear. ENU-induced mutant mice show omphalocele, impaired neural tube, heart and lung development, rib defects, polydactyly, failed eyelid closure and altered cell polarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,792 I157K probably benign Het
Ank3 A T 10: 70,001,982 N727Y probably benign Het
Atg16l1 A G 1: 87,774,188 T251A probably benign Het
Bcl11b T A 12: 107,917,163 I226F probably damaging Het
Birc6 A G 17: 74,662,742 H4260R probably damaging Het
Camta1 A G 4: 151,586,463 I85T probably damaging Het
Cblb A G 16: 52,033,010 probably benign Het
Ccnd1 T G 7: 144,937,336 I178L probably benign Het
Clcn4 A G 7: 7,291,682 V329A probably damaging Het
Col17a1 C T 19: 47,648,910 probably benign Het
Col7a1 A G 9: 108,955,966 T254A unknown Het
Ctif C A 18: 75,565,025 R188L probably damaging Het
Cyp2c69 A T 19: 39,842,986 L461Q probably benign Het
Ddc A G 11: 11,846,656 probably null Het
Dpp10 T A 1: 123,341,380 probably null Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Eif2b4 T C 5: 31,192,921 E19G possibly damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galnt14 A G 17: 73,525,313 L269P possibly damaging Het
Gm14409 T C 2: 177,265,585 E40G probably damaging Het
Gm2381 T A 7: 42,822,401 H18L probably benign Het
Gpbp1 G T 13: 111,436,579 D326E probably benign Het
Gpr162 C T 6: 124,860,088 R331H probably damaging Het
Iigp1 G A 18: 60,389,876 G22D probably benign Het
Kcns3 T C 12: 11,092,083 H205R probably damaging Het
Klk1b26 C T 7: 44,016,402 probably benign Het
Lime1 A G 2: 181,383,376 Y242C probably benign Het
Manba A G 3: 135,544,806 D398G probably damaging Het
Mapk3 A T 7: 126,763,512 K219* probably null Het
Mdfic G T 6: 15,799,845 G324C probably damaging Het
Mdga1 G A 17: 29,837,998 H837Y probably damaging Het
Nck1 T A 9: 100,497,872 M109L probably benign Het
Olfr1369-ps1 T C 13: 21,116,118 V142A probably benign Het
Olfr412 A G 11: 74,365,250 I194V probably benign Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Phf3 C T 1: 30,804,842 V1679I probably benign Het
Pou4f1 T C 14: 104,467,640 I32V probably benign Het
Pspc1 T G 14: 56,748,941 H351P probably damaging Het
Rab23 A G 1: 33,738,297 Y164C possibly damaging Het
Slc36a3 A G 11: 55,142,770 W141R probably damaging Het
Slc7a14 T C 3: 31,224,118 E446G possibly damaging Het
Stim2 G A 5: 54,105,325 R303Q probably damaging Het
Tbcd A G 11: 121,560,753 I550V probably benign Het
Tmed3 A C 9: 89,699,945 L155R probably damaging Het
Trav16d-dv11 A G 14: 53,047,342 probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Usp16 G T 16: 87,464,834 V113F probably damaging Het
Vmn2r12 T G 5: 109,092,830 Y139S probably benign Het
Vmn2r5 G T 3: 64,504,000 D382E probably damaging Het
Zfp217 A C 2: 170,114,470 N869K probably benign Het
Zswim2 G T 2: 83,923,748 D189E probably benign Het
Other mutations in Ptk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Ptk7 APN 17 46574427 missense probably damaging 1.00
IGL01064:Ptk7 APN 17 46573566 nonsense probably null
IGL01444:Ptk7 APN 17 46565387 missense probably damaging 1.00
IGL01477:Ptk7 APN 17 46576880 missense possibly damaging 0.61
IGL01727:Ptk7 APN 17 46572548 missense probably damaging 1.00
IGL01958:Ptk7 APN 17 46579427 missense probably benign 0.37
IGL02496:Ptk7 APN 17 46590144 missense probably benign 0.04
IGL02864:Ptk7 APN 17 46572733 missense probably damaging 1.00
R0008:Ptk7 UTSW 17 46572762 splice site probably benign
R0671:Ptk7 UTSW 17 46590312 missense possibly damaging 0.94
R1464:Ptk7 UTSW 17 46572591 missense probably damaging 1.00
R1464:Ptk7 UTSW 17 46572591 missense probably damaging 1.00
R1635:Ptk7 UTSW 17 46573534 missense possibly damaging 0.81
R1646:Ptk7 UTSW 17 46586297 missense probably benign 0.44
R1846:Ptk7 UTSW 17 46576490 critical splice donor site probably null
R1973:Ptk7 UTSW 17 46586807 nonsense probably null
R2060:Ptk7 UTSW 17 46566238 missense possibly damaging 0.83
R2155:Ptk7 UTSW 17 46579617 missense probably benign 0.09
R2472:Ptk7 UTSW 17 46576848 missense probably benign 0.35
R2937:Ptk7 UTSW 17 46572550 missense probably damaging 0.99
R3824:Ptk7 UTSW 17 46565378 missense probably damaging 1.00
R3845:Ptk7 UTSW 17 46586418 missense probably benign 0.00
R4222:Ptk7 UTSW 17 46574463 missense probably benign
R4671:Ptk7 UTSW 17 46574466 missense probably benign
R4922:Ptk7 UTSW 17 46576491 critical splice donor site probably null
R5319:Ptk7 UTSW 17 46572677 missense probably damaging 1.00
R5993:Ptk7 UTSW 17 46565370 missense probably benign
R6254:Ptk7 UTSW 17 46572642 missense probably damaging 1.00
R6352:Ptk7 UTSW 17 46576890 missense probably benign 0.00
R6806:Ptk7 UTSW 17 46573528 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCCCAGAACTTAAGATTGACCTCC -3'
(R):5'- GGCTTGTGCTCTAAGAAAGGCCAC -3'

Sequencing Primer
(F):5'- AGGAGGCAAGCTCTGTCTG -3'
(R):5'- TTTTGCCAACGCGGTTCT -3'
Posted On2014-04-13