Incidental Mutation 'R1549:Cyp2c69'
ID169811
Institutional Source Beutler Lab
Gene Symbol Cyp2c69
Ensembl Gene ENSMUSG00000092008
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 69
SynonymsAI098658
MMRRC Submission 039588-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R1549 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location39842660-39886769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39842986 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 461 (L461Q)
Ref Sequence ENSEMBL: ENSMUSP00000132832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168838]
Predicted Effect probably benign
Transcript: ENSMUST00000168838
AA Change: L461Q

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000132832
Gene: ENSMUSG00000092008
AA Change: L461Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 7e-152 PFAM
Meta Mutation Damage Score 0.1284 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,792 I157K probably benign Het
Ank3 A T 10: 70,001,982 N727Y probably benign Het
Atg16l1 A G 1: 87,774,188 T251A probably benign Het
Bcl11b T A 12: 107,917,163 I226F probably damaging Het
Birc6 A G 17: 74,662,742 H4260R probably damaging Het
Camta1 A G 4: 151,586,463 I85T probably damaging Het
Cblb A G 16: 52,033,010 probably benign Het
Ccnd1 T G 7: 144,937,336 I178L probably benign Het
Clcn4 A G 7: 7,291,682 V329A probably damaging Het
Col17a1 C T 19: 47,648,910 probably benign Het
Col7a1 A G 9: 108,955,966 T254A unknown Het
Ctif C A 18: 75,565,025 R188L probably damaging Het
Ddc A G 11: 11,846,656 probably null Het
Dpp10 T A 1: 123,341,380 probably null Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Eif2b4 T C 5: 31,192,921 E19G possibly damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galnt14 A G 17: 73,525,313 L269P possibly damaging Het
Gm14409 T C 2: 177,265,585 E40G probably damaging Het
Gm2381 T A 7: 42,822,401 H18L probably benign Het
Gpbp1 G T 13: 111,436,579 D326E probably benign Het
Gpr162 C T 6: 124,860,088 R331H probably damaging Het
Iigp1 G A 18: 60,389,876 G22D probably benign Het
Kcns3 T C 12: 11,092,083 H205R probably damaging Het
Klk1b26 C T 7: 44,016,402 probably benign Het
Lime1 A G 2: 181,383,376 Y242C probably benign Het
Manba A G 3: 135,544,806 D398G probably damaging Het
Mapk3 A T 7: 126,763,512 K219* probably null Het
Mdfic G T 6: 15,799,845 G324C probably damaging Het
Mdga1 G A 17: 29,837,998 H837Y probably damaging Het
Nck1 T A 9: 100,497,872 M109L probably benign Het
Olfr1369-ps1 T C 13: 21,116,118 V142A probably benign Het
Olfr412 A G 11: 74,365,250 I194V probably benign Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Phf3 C T 1: 30,804,842 V1679I probably benign Het
Pou4f1 T C 14: 104,467,640 I32V probably benign Het
Pspc1 T G 14: 56,748,941 H351P probably damaging Het
Ptk7 T C 17: 46,572,652 E829G probably damaging Het
Rab23 A G 1: 33,738,297 Y164C possibly damaging Het
Slc36a3 A G 11: 55,142,770 W141R probably damaging Het
Slc7a14 T C 3: 31,224,118 E446G possibly damaging Het
Stim2 G A 5: 54,105,325 R303Q probably damaging Het
Tbcd A G 11: 121,560,753 I550V probably benign Het
Tmed3 A C 9: 89,699,945 L155R probably damaging Het
Trav16d-dv11 A G 14: 53,047,342 probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Usp16 G T 16: 87,464,834 V113F probably damaging Het
Vmn2r12 T G 5: 109,092,830 Y139S probably benign Het
Vmn2r5 G T 3: 64,504,000 D382E probably damaging Het
Zfp217 A C 2: 170,114,470 N869K probably benign Het
Zswim2 G T 2: 83,923,748 D189E probably benign Het
Other mutations in Cyp2c69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01873:Cyp2c69 APN 19 39881249 splice site probably benign
IGL02127:Cyp2c69 APN 19 39851057 missense probably damaging 0.99
IGL02945:Cyp2c69 APN 19 39886647 missense possibly damaging 0.81
IGL03067:Cyp2c69 APN 19 39881093 missense probably benign 0.29
IGL03069:Cyp2c69 APN 19 39881093 missense probably benign 0.29
R0545:Cyp2c69 UTSW 19 39886661 missense probably damaging 1.00
R1276:Cyp2c69 UTSW 19 39876224 missense possibly damaging 0.47
R1468:Cyp2c69 UTSW 19 39849395 missense probably damaging 1.00
R1468:Cyp2c69 UTSW 19 39849395 missense probably damaging 1.00
R1534:Cyp2c69 UTSW 19 39851149 missense probably benign
R1703:Cyp2c69 UTSW 19 39876366 missense probably benign 0.10
R1752:Cyp2c69 UTSW 19 39881153 missense probably damaging 1.00
R1769:Cyp2c69 UTSW 19 39876371 missense probably benign 0.00
R1843:Cyp2c69 UTSW 19 39877528 missense probably benign 0.27
R1938:Cyp2c69 UTSW 19 39849366 missense probably damaging 0.97
R2100:Cyp2c69 UTSW 19 39886686 missense probably benign 0.11
R2366:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R2367:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R2440:Cyp2c69 UTSW 19 39876294 missense probably benign 0.17
R2931:Cyp2c69 UTSW 19 39849483 missense probably damaging 1.00
R3709:Cyp2c69 UTSW 19 39851223 splice site probably benign
R3793:Cyp2c69 UTSW 19 39881156 missense probably benign 0.44
R3898:Cyp2c69 UTSW 19 39876390 missense probably benign 0.00
R4579:Cyp2c69 UTSW 19 39881186 missense possibly damaging 0.89
R4707:Cyp2c69 UTSW 19 39849408 missense probably benign 0.39
R4778:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4779:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4780:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4838:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4877:Cyp2c69 UTSW 19 39877612 missense probably damaging 1.00
R5488:Cyp2c69 UTSW 19 39851159 missense probably null 0.94
R5489:Cyp2c69 UTSW 19 39851159 missense probably null 0.94
R6083:Cyp2c69 UTSW 19 39849456 missense probably damaging 1.00
R6278:Cyp2c69 UTSW 19 39843063 nonsense probably null
R6415:Cyp2c69 UTSW 19 39842921 missense probably benign 0.44
R6732:Cyp2c69 UTSW 19 39881499 missense probably benign
R6858:Cyp2c69 UTSW 19 39877565 missense probably benign 0.19
R7023:Cyp2c69 UTSW 19 39877542 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ACTTTCAGCCTTGGGCAATTAGAGAAC -3'
(R):5'- ACACAATGCCTCTCAAACTCACTTATGT -3'

Sequencing Primer
(F):5'- AATTTCTGGGACTGGGTTAAATGAG -3'
(R):5'- GTATGAGGCATAGTTACCTTCTTTC -3'
Posted On2014-04-13