Incidental Mutation 'R1550:Grin1'
ID169821
Institutional Source Beutler Lab
Gene Symbol Grin1
Ensembl Gene ENSMUSG00000026959
Gene Nameglutamate receptor, ionotropic, NMDA1 (zeta 1)
SynonymsRgsc174, M100174, NR1, GluRzeta1, NMDAR1, Nmdar
MMRRC Submission 039589-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1550 (G1)
Quality Score142
Status Not validated
Chromosome2
Chromosomal Location25291181-25319187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25305131 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 292 (V292A)
Ref Sequence ENSEMBL: ENSMUSP00000028335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028335] [ENSMUST00000114307] [ENSMUST00000114308] [ENSMUST00000114310] [ENSMUST00000114312] [ENSMUST00000114314] [ENSMUST00000114317] [ENSMUST00000114318]
Predicted Effect probably benign
Transcript: ENSMUST00000028335
AA Change: V292A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000028335
Gene: ENSMUSG00000026959
AA Change: V292A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 6.6e-35 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 1.5e-18 PFAM
PDB:3BYA|B 875 898 4e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114307
AA Change: V292A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000109946
Gene: ENSMUSG00000026959
AA Change: V292A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 1e-34 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 3.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114308
AA Change: V313A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000109947
Gene: ENSMUSG00000026959
AA Change: V313A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 8e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114310
AA Change: V313A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000109949
Gene: ENSMUSG00000026959
AA Change: V313A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 39 299 3.6e-24 PFAM
Blast:PBPe 352 420 9e-37 BLAST
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 8.4e-17 PFAM
PDB:3BYA|B 896 919 4e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114312
AA Change: V292A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000109951
Gene: ENSMUSG00000026959
AA Change: V292A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 5.9e-35 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 1.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114314
AA Change: V292A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109953
Gene: ENSMUSG00000026959
AA Change: V292A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 1.1e-34 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 3.3e-19 PFAM
PDB:3BYA|B 875 898 4e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114317
AA Change: V313A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109956
Gene: ENSMUSG00000026959
AA Change: V313A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 7.7e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114318
AA Change: V313A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109957
Gene: ENSMUSG00000026959
AA Change: V313A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 8.4e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.4e-19 PFAM
PDB:3BYA|B 896 919 4e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153551
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a critical subunit of N-methyl-D-aspartate receptors, members of the glutamate receptor channel superfamily which are heteromeric protein complexes with multiple subunits arranged to form a ligand-gated ion channel. These subunits play a key role in the plasticity of synapses, which is believed to underlie memory and learning. Cell-specific factors are thought to control expression of different isoforms, possibly contributing to the functional diversity of the subunits. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mutants lack whisker patterns in brain cortex, are ataxic and die neonatally of respiratory failure. Hypomorph mutants exhibit hyperactivity, stereotypy, and impaired social/sexual interactions. Mice homozygous for an ENU-induced allele exhibit abnormal behavior and neuron physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Abcc6 A G 7: 46,005,244 V551A probably benign Het
Acss1 A T 2: 150,642,795 L176Q probably damaging Het
Aldh7a1 A G 18: 56,550,382 I117T possibly damaging Het
Arf5 C T 6: 28,426,153 R180C probably damaging Het
Arhgap21 A T 2: 20,881,765 Y39* probably null Het
Arrdc1 A G 2: 24,926,339 L206P probably damaging Het
Cby3 A T 11: 50,359,486 Y173F probably damaging Het
Cdh18 T A 15: 23,436,548 C497S probably damaging Het
Cyp11b2 T C 15: 74,853,593 I226V probably benign Het
Ddit4l T A 3: 137,624,275 probably null Het
Ddx11 C T 17: 66,138,220 T405I probably benign Het
Dhx40 A T 11: 86,776,739 probably null Het
Dlgap2 A G 8: 14,822,499 D659G probably damaging Het
Eef2 A G 10: 81,180,847 E586G probably benign Het
Fam161a A G 11: 23,020,470 Q216R possibly damaging Het
Fbxw24 G T 9: 109,607,044 R307S probably benign Het
Gbp2b G T 3: 142,606,830 A325S probably damaging Het
Gli1 A T 10: 127,338,516 F2Y probably damaging Het
Gm7075 A G 10: 63,421,648 L31P probably damaging Het
Gnl2 T C 4: 125,044,234 V269A probably damaging Het
Heg1 T A 16: 33,735,553 V1001E probably damaging Het
Herc2 T A 7: 56,135,658 I1552N probably damaging Het
Htr1a A G 13: 105,445,280 T343A probably benign Het
Itk G T 11: 46,389,326 R29S probably damaging Het
Ivns1abp G T 1: 151,361,491 G469C probably damaging Het
Jph3 A T 8: 121,784,859 N529Y possibly damaging Het
Kdm2b A G 5: 122,881,057 L829P probably damaging Het
Kprp T A 3: 92,824,726 Y339F probably damaging Het
Lrp2 A G 2: 69,502,661 V1504A possibly damaging Het
Lypd6b A G 2: 49,943,603 D85G probably damaging Het
Mansc4 T C 6: 147,075,638 Y160C probably damaging Het
Mgll C A 6: 88,813,889 H164N probably benign Het
Mtmr4 A T 11: 87,613,516 D1097V probably damaging Het
Nfasc T C 1: 132,608,503 K571E probably damaging Het
Nfat5 A T 8: 107,370,573 N1527Y probably damaging Het
Nlgn1 A G 3: 25,912,644 L215P probably damaging Het
Olfr6 T A 7: 106,956,028 I303L probably benign Het
Pde4dip T C 3: 97,719,704 S1173G probably damaging Het
Prrt3 A T 6: 113,495,507 V568E probably damaging Het
Ptpra G A 2: 130,541,393 R503Q possibly damaging Het
Sema5a G A 15: 32,618,849 A508T probably benign Het
Serpinb11 T C 1: 107,379,688 I283T possibly damaging Het
Setbp1 A T 18: 78,858,592 L620Q probably damaging Het
Sipa1l3 A T 7: 29,383,203 C756S probably benign Het
Sirpa A T 2: 129,630,041 I463F probably damaging Het
Slc13a2 G T 11: 78,403,164 N257K probably damaging Het
Slc4a5 C A 6: 83,271,057 T530N probably damaging Het
Stab2 A T 10: 86,878,926 F125L probably benign Het
Tet2 G T 3: 133,469,519 Q1356K probably benign Het
Tet3 A T 6: 83,386,028 S856T probably damaging Het
Tg C T 15: 66,693,430 T1207I possibly damaging Het
Tkt A G 14: 30,565,568 Y173C probably damaging Het
Tlr6 T A 5: 64,953,411 I718F probably damaging Het
Tnfrsf11b A G 15: 54,254,058 V267A possibly damaging Het
Ubqln3 T A 7: 104,141,546 N446Y probably damaging Het
Vmn2r118 C T 17: 55,608,083 C521Y probably damaging Het
Vps16 A G 2: 130,440,340 D394G probably benign Het
Zfp236 A T 18: 82,674,424 M142K possibly damaging Het
Zfp780b T C 7: 27,964,857 D91G probably benign Het
Zfp97 T A 17: 17,145,206 Y322* probably null Het
Other mutations in Grin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Grin1 APN 2 25296967 missense possibly damaging 0.93
IGL01627:Grin1 APN 2 25318697 missense probably damaging 1.00
IGL02039:Grin1 APN 2 25305342 missense probably damaging 0.98
IGL02074:Grin1 APN 2 25298502 missense possibly damaging 0.81
IGL02083:Grin1 APN 2 25298501 missense possibly damaging 0.93
IGL03334:Grin1 APN 2 25298393 critical splice donor site probably null
IGL03349:Grin1 APN 2 25310436 missense probably benign
PIT4283001:Grin1 UTSW 2 25297852 missense probably damaging 1.00
R0038:Grin1 UTSW 2 25297459 missense probably null 0.82
R0829:Grin1 UTSW 2 25298448 missense probably benign 0.08
R1454:Grin1 UTSW 2 25292430 nonsense probably null
R1969:Grin1 UTSW 2 25297915 missense probably benign 0.01
R2057:Grin1 UTSW 2 25316820 missense probably damaging 1.00
R2424:Grin1 UTSW 2 25318652 missense probably null 1.00
R2877:Grin1 UTSW 2 25297629 missense probably damaging 1.00
R2878:Grin1 UTSW 2 25297629 missense probably damaging 1.00
R3420:Grin1 UTSW 2 25303914 missense probably damaging 0.97
R3422:Grin1 UTSW 2 25303914 missense probably damaging 0.97
R3958:Grin1 UTSW 2 25313453 missense probably damaging 1.00
R4222:Grin1 UTSW 2 25297320 intron probably benign
R4224:Grin1 UTSW 2 25297320 intron probably benign
R4225:Grin1 UTSW 2 25297320 intron probably benign
R4409:Grin1 UTSW 2 25310439 missense possibly damaging 0.75
R4723:Grin1 UTSW 2 25294470 missense probably benign 0.30
R4775:Grin1 UTSW 2 25292463 missense possibly damaging 0.92
R4783:Grin1 UTSW 2 25292381 missense possibly damaging 0.86
R4784:Grin1 UTSW 2 25292381 missense possibly damaging 0.86
R4785:Grin1 UTSW 2 25292381 missense possibly damaging 0.86
R4829:Grin1 UTSW 2 25318724 missense possibly damaging 0.47
R4915:Grin1 UTSW 2 25298553 intron probably benign
R5064:Grin1 UTSW 2 25303831 intron probably benign
R5103:Grin1 UTSW 2 25310421 missense probably benign
R5125:Grin1 UTSW 2 25296827 intron probably benign
R5215:Grin1 UTSW 2 25303907 missense probably benign 0.00
R5419:Grin1 UTSW 2 25298273 synonymous probably null
R6119:Grin1 UTSW 2 25305158 missense probably damaging 1.00
R6616:Grin1 UTSW 2 25292110 missense possibly damaging 0.82
R6894:Grin1 UTSW 2 25295817 missense probably damaging 1.00
R7101:Grin1 UTSW 2 25296635 missense probably damaging 0.98
R7137:Grin1 UTSW 2 25313538 missense probably benign
X0026:Grin1 UTSW 2 25305098 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGGATTTGCGATGGAGGTGACTAAC -3'
(R):5'- TGAACATGACTGGCTCTGGGTACG -3'

Sequencing Primer
(F):5'- CTTGTCCTAGATAAGACCGGC -3'
(R):5'- AGATCTCTGGGAATGCCCTG -3'
Posted On2014-04-13