Incidental Mutation 'R1550:Stab2'
ID169859
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Namestabilin 2
SynonymsSTAB-2, FEEL-2
MMRRC Submission 039589-MU
Accession Numbers

Genbank: NM_138673; MGI: 2178743

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1550 (G1)
Quality Score208
Status Not validated
Chromosome10
Chromosomal Location86841198-87008025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86878926 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 125 (F125L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
Predicted Effect probably benign
Transcript: ENSMUST00000035288
AA Change: F1576L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: F1576L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159023
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159445
Predicted Effect probably benign
Transcript: ENSMUST00000161560
AA Change: F125L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000125263
Gene: ENSMUSG00000035459
AA Change: F125L

DomainStartEndE-ValueType
EGF 30 68 1.64e-1 SMART
EGF 72 110 1.14e0 SMART
EGF 114 152 5.62e0 SMART
FAS1 187 283 2.23e-25 SMART
FAS1 334 440 6.92e-22 SMART
EGF 515 555 1.95e1 SMART
EGF_like 526 566 2.46e-1 SMART
EGF 565 599 1.14e0 SMART
EGF 607 638 1.56e1 SMART
EGF 643 680 1.36e1 SMART
EGF 684 723 2.13e0 SMART
LINK 754 848 2.08e-29 SMART
Predicted Effect unknown
Transcript: ENSMUST00000219341
AA Change: F124L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219659
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Abcc6 A G 7: 46,005,244 V551A probably benign Het
Acss1 A T 2: 150,642,795 L176Q probably damaging Het
Aldh7a1 A G 18: 56,550,382 I117T possibly damaging Het
Arf5 C T 6: 28,426,153 R180C probably damaging Het
Arhgap21 A T 2: 20,881,765 Y39* probably null Het
Arrdc1 A G 2: 24,926,339 L206P probably damaging Het
Cby3 A T 11: 50,359,486 Y173F probably damaging Het
Cdh18 T A 15: 23,436,548 C497S probably damaging Het
Cyp11b2 T C 15: 74,853,593 I226V probably benign Het
Ddit4l T A 3: 137,624,275 probably null Het
Ddx11 C T 17: 66,138,220 T405I probably benign Het
Dhx40 A T 11: 86,776,739 probably null Het
Dlgap2 A G 8: 14,822,499 D659G probably damaging Het
Eef2 A G 10: 81,180,847 E586G probably benign Het
Fam161a A G 11: 23,020,470 Q216R possibly damaging Het
Fbxw24 G T 9: 109,607,044 R307S probably benign Het
Gbp2b G T 3: 142,606,830 A325S probably damaging Het
Gli1 A T 10: 127,338,516 F2Y probably damaging Het
Gm7075 A G 10: 63,421,648 L31P probably damaging Het
Gnl2 T C 4: 125,044,234 V269A probably damaging Het
Grin1 A G 2: 25,305,131 V292A probably benign Het
Heg1 T A 16: 33,735,553 V1001E probably damaging Het
Herc2 T A 7: 56,135,658 I1552N probably damaging Het
Htr1a A G 13: 105,445,280 T343A probably benign Het
Itk G T 11: 46,389,326 R29S probably damaging Het
Ivns1abp G T 1: 151,361,491 G469C probably damaging Het
Jph3 A T 8: 121,784,859 N529Y possibly damaging Het
Kdm2b A G 5: 122,881,057 L829P probably damaging Het
Kprp T A 3: 92,824,726 Y339F probably damaging Het
Lrp2 A G 2: 69,502,661 V1504A possibly damaging Het
Lypd6b A G 2: 49,943,603 D85G probably damaging Het
Mansc4 T C 6: 147,075,638 Y160C probably damaging Het
Mgll C A 6: 88,813,889 H164N probably benign Het
Mtmr4 A T 11: 87,613,516 D1097V probably damaging Het
Nfasc T C 1: 132,608,503 K571E probably damaging Het
Nfat5 A T 8: 107,370,573 N1527Y probably damaging Het
Nlgn1 A G 3: 25,912,644 L215P probably damaging Het
Olfr6 T A 7: 106,956,028 I303L probably benign Het
Pde4dip T C 3: 97,719,704 S1173G probably damaging Het
Prrt3 A T 6: 113,495,507 V568E probably damaging Het
Ptpra G A 2: 130,541,393 R503Q possibly damaging Het
Sema5a G A 15: 32,618,849 A508T probably benign Het
Serpinb11 T C 1: 107,379,688 I283T possibly damaging Het
Setbp1 A T 18: 78,858,592 L620Q probably damaging Het
Sipa1l3 A T 7: 29,383,203 C756S probably benign Het
Sirpa A T 2: 129,630,041 I463F probably damaging Het
Slc13a2 G T 11: 78,403,164 N257K probably damaging Het
Slc4a5 C A 6: 83,271,057 T530N probably damaging Het
Tet2 G T 3: 133,469,519 Q1356K probably benign Het
Tet3 A T 6: 83,386,028 S856T probably damaging Het
Tg C T 15: 66,693,430 T1207I possibly damaging Het
Tkt A G 14: 30,565,568 Y173C probably damaging Het
Tlr6 T A 5: 64,953,411 I718F probably damaging Het
Tnfrsf11b A G 15: 54,254,058 V267A possibly damaging Het
Ubqln3 T A 7: 104,141,546 N446Y probably damaging Het
Vmn2r118 C T 17: 55,608,083 C521Y probably damaging Het
Vps16 A G 2: 130,440,340 D394G probably benign Het
Zfp236 A T 18: 82,674,424 M142K possibly damaging Het
Zfp780b T C 7: 27,964,857 D91G probably benign Het
Zfp97 T A 17: 17,145,206 Y322* probably null Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86869206 unclassified probably null
IGL00809:Stab2 APN 10 86848174 splice site probably benign
IGL00911:Stab2 APN 10 86969753 missense probably damaging 1.00
IGL01347:Stab2 APN 10 86901703 splice site probably null
IGL01411:Stab2 APN 10 86980008 splice site probably benign
IGL01503:Stab2 APN 10 86940613 splice site probably benign
IGL01599:Stab2 APN 10 86922895 missense probably damaging 1.00
IGL01635:Stab2 APN 10 86981128 missense probably benign 0.04
IGL01640:Stab2 APN 10 86954171 missense probably benign 0.09
IGL01671:Stab2 APN 10 86969277 missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86871831 missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86967650 missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86859742 unclassified probably null
IGL02600:Stab2 APN 10 86954259 missense probably damaging 1.00
IGL02666:Stab2 APN 10 86850902 missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86846163 splice site probably benign
IGL02709:Stab2 APN 10 86846165 splice site probably benign
IGL02728:Stab2 APN 10 86856556 missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86950269 splice site probably benign
IGL02938:Stab2 APN 10 86871921 missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86996803 critical splice donor site probably null
IGL03238:Stab2 APN 10 86855121 missense probably damaging 1.00
IGL03402:Stab2 APN 10 86969301 missense probably benign 0.03
3-1:Stab2 UTSW 10 86869177 missense probably damaging 0.96
F6893:Stab2 UTSW 10 86855171 missense probably damaging 1.00
K7371:Stab2 UTSW 10 86943289 critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86867175 missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86861435 nonsense probably null
R0015:Stab2 UTSW 10 86843617 missense probably benign
R0254:Stab2 UTSW 10 86897960 missense probably benign
R0310:Stab2 UTSW 10 86967613 splice site probably benign
R0333:Stab2 UTSW 10 86841627 missense probably benign
R0391:Stab2 UTSW 10 86947144 missense probably benign 0.27
R0400:Stab2 UTSW 10 86872610 missense probably damaging 1.00
R0433:Stab2 UTSW 10 86843491 splice site probably benign
R0440:Stab2 UTSW 10 86949928 missense probably benign 0.23
R0743:Stab2 UTSW 10 86887895 missense probably damaging 1.00
R0847:Stab2 UTSW 10 86969871 missense probably benign 0.00
R0883:Stab2 UTSW 10 86924450 splice site probably benign
R1078:Stab2 UTSW 10 86907133 splice site probably null
R1118:Stab2 UTSW 10 86885718 unclassified probably null
R1119:Stab2 UTSW 10 86859755 missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86950301 missense probably damaging 0.98
R1440:Stab2 UTSW 10 86861367 unclassified probably null
R1616:Stab2 UTSW 10 86885718 unclassified probably null
R1728:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1768:Stab2 UTSW 10 87003008 missense probably damaging 1.00
R1772:Stab2 UTSW 10 86954234 missense probably benign 0.06
R1776:Stab2 UTSW 10 86957816 missense possibly damaging 0.92
R1784:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1892:Stab2 UTSW 10 86938049 missense probably damaging 0.99
R1957:Stab2 UTSW 10 86861470 missense probably benign 0.13
R1972:Stab2 UTSW 10 86960316 missense probably damaging 0.99
R1975:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1976:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1996:Stab2 UTSW 10 87003031 missense probably damaging 1.00
R2085:Stab2 UTSW 10 86954159 missense probably damaging 1.00
R2149:Stab2 UTSW 10 86865040 nonsense probably null
R2169:Stab2 UTSW 10 86887862 missense probably damaging 1.00
R2201:Stab2 UTSW 10 86940639 missense probably benign 0.22
R2296:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86969319 missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86934840 splice site probably benign
R2696:Stab2 UTSW 10 86861499 missense probably benign 0.45
R2883:Stab2 UTSW 10 86967686 missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86861461 missense probably damaging 1.00
R3711:Stab2 UTSW 10 86866708 missense probably damaging 1.00
R3787:Stab2 UTSW 10 86969277 missense possibly damaging 0.50
R3834:Stab2 UTSW 10 86949912 missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86878886 missense probably damaging 0.97
R3979:Stab2 UTSW 10 86863456 missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86858124 missense probably damaging 1.00
R4088:Stab2 UTSW 10 86922185 missense probably damaging 1.00
R4151:Stab2 UTSW 10 87002983 missense probably benign 0.12
R4190:Stab2 UTSW 10 86878944 missense probably damaging 0.98
R4556:Stab2 UTSW 10 86967679 missense possibly damaging 0.95
R4773:Stab2 UTSW 10 86907371 nonsense probably null
R4825:Stab2 UTSW 10 86947147 missense probably benign 0.08
R4865:Stab2 UTSW 10 86843500 unclassified probably null
R4871:Stab2 UTSW 10 86942235 missense probably damaging 0.99
R4943:Stab2 UTSW 10 86954162 missense probably damaging 0.99
R4981:Stab2 UTSW 10 86960223 missense probably benign
R4994:Stab2 UTSW 10 86949907 missense probably benign
R4999:Stab2 UTSW 10 86937909 missense probably damaging 0.97
R5061:Stab2 UTSW 10 86907385 missense probably damaging 1.00
R5072:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5073:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5074:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5134:Stab2 UTSW 10 86871810 unclassified probably null
R5213:Stab2 UTSW 10 86907197 missense probably damaging 0.99
R5508:Stab2 UTSW 10 86960279 missense probably benign 0.01
R5530:Stab2 UTSW 10 86947162 missense probably benign 0.04
R5540:Stab2 UTSW 10 86848125 missense probably benign 0.30
R5839:Stab2 UTSW 10 86872691 missense probably damaging 0.97
R5949:Stab2 UTSW 10 86969849 missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86938042 missense probably damaging 0.99
R6019:Stab2 UTSW 10 87003022 missense probably benign 0.00
R6116:Stab2 UTSW 10 86907190 missense probably damaging 1.00
R6131:Stab2 UTSW 10 86883778 unclassified probably null
R6209:Stab2 UTSW 10 86923003 missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86907161 missense probably damaging 1.00
R6433:Stab2 UTSW 10 86901567 splice site probably null
R6787:Stab2 UTSW 10 86919084 missense probably benign 0.07
R6841:Stab2 UTSW 10 86942190 missense probably damaging 1.00
R6873:Stab2 UTSW 10 86861366 critical splice donor site probably null
R7025:Stab2 UTSW 10 86850837 missense probably damaging 1.00
R7043:Stab2 UTSW 10 86870246 missense probably damaging 0.99
R7047:Stab2 UTSW 10 86858152 missense probably damaging 1.00
R7107:Stab2 UTSW 10 86905592 missense possibly damaging 0.96
R7214:Stab2 UTSW 10 86899841 missense probably damaging 0.99
R7271:Stab2 UTSW 10 87003108 splice site probably null
R7291:Stab2 UTSW 10 86946220 missense probably damaging 0.96
R7336:Stab2 UTSW 10 86969185 nonsense probably null
R7432:Stab2 UTSW 10 86885683 missense probably damaging 0.99
X0023:Stab2 UTSW 10 86922198 critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86887816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCAGAGTTCAATTTCAAACGCAG -3'
(R):5'- TAATGACCCACAACCAAGGGGCTG -3'

Sequencing Primer
(F):5'- tcaatttcaaacgcagatgtttc -3'
(R):5'- tgtgtgtgtgtgttactaggg -3'
Posted On2014-04-13