Incidental Mutation 'R1551:Slc6a17'
ID169901
Institutional Source Beutler Lab
Gene Symbol Slc6a17
Ensembl Gene ENSMUSG00000027894
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 17
SynonymsNTT4, D130012J15Rik
MMRRC Submission 039590-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.450) question?
Stock #R1551 (G1)
Quality Score203
Status Not validated
Chromosome3
Chromosomal Location107467543-107518018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107472127 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 575 (V575A)
Ref Sequence ENSEMBL: ENSMUSP00000129379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029499] [ENSMUST00000168211] [ENSMUST00000169449]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029499
AA Change: V572A

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029499
Gene: ENSMUSG00000027894
AA Change: V572A

DomainStartEndE-ValueType
Pfam:SNF 60 640 2.7e-227 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168211
AA Change: V534A

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131888
Gene: ENSMUSG00000027894
AA Change: V534A

DomainStartEndE-ValueType
Pfam:SNF 19 602 1.3e-225 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169449
AA Change: V575A

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129379
Gene: ENSMUSG00000027894
AA Change: V575A

DomainStartEndE-ValueType
Pfam:SNF 60 643 1.1e-225 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171029
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 83.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SLC6 family of transporters, which are responsible for the presynaptic uptake of most neurotransmitters. The encoded vesicular transporter is selective for proline, glycine, leucine and alanine. Defects in this gene are a cause of autosomal recessive mental retardation-48. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,318,878 I1534M probably benign Het
Acad11 G A 9: 104,126,586 A626T probably damaging Het
Akap9 T A 5: 4,069,174 N3560K probably benign Het
Aldh3a2 C T 11: 61,253,644 V363I probably benign Het
Anks1b A G 10: 90,076,981 T289A probably benign Het
Atp11a A G 8: 12,812,340 N64S probably damaging Het
Atp11c T C X: 60,236,712 probably null Het
Cd101 T C 3: 101,012,013 H591R probably damaging Het
Cd36 C T 5: 17,797,122 V294I probably benign Het
Cgref1 T C 5: 30,933,585 E295G probably benign Het
Cit A G 5: 115,945,842 M787V probably benign Het
Clcn6 G A 4: 148,012,778 P611S possibly damaging Het
Clec12a A C 6: 129,350,421 M1L probably damaging Het
Cmtm6 C T 9: 114,746,505 R161W probably damaging Het
Colec10 G T 15: 54,462,262 V163L probably damaging Het
Coq8b A G 7: 27,257,482 Y520C probably damaging Het
Ctsll3 C A 13: 60,801,007 E45* probably null Het
Dsg3 A G 18: 20,536,918 E663G possibly damaging Het
Dst G A 1: 34,192,212 R2962H probably benign Het
Etnk2 T C 1: 133,373,257 I254T probably damaging Het
Fbxo36 T C 1: 84,881,114 I40T probably damaging Het
Fgd2 G A 17: 29,378,409 V568M probably damaging Het
Fmn1 T C 2: 113,525,862 Y883H possibly damaging Het
Fpr-rs4 A T 17: 18,022,327 T199S possibly damaging Het
Gm12789 A G 4: 101,988,934 K131E probably benign Het
Gm17641 C A 3: 68,870,115 silent Het
Gm6665 G T 18: 31,820,287 R43S probably damaging Het
Gm7173 C A X: 79,488,645 L842F probably damaging Het
Gzmc T A 14: 56,232,746 H98L probably damaging Het
Hecw1 T A 13: 14,316,943 E75V probably damaging Het
Herc2 G T 7: 56,146,669 V1930L probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Htr6 A T 4: 139,074,465 C99* probably null Het
Lgals2 C T 15: 78,852,311 M16I probably benign Het
Lrrc8c A G 5: 105,608,224 N622D probably damaging Het
Myo15 A T 11: 60,492,965 I1613F possibly damaging Het
Oacyl C T 18: 65,742,209 R455C probably benign Het
Olfr1323 T C X: 50,009,995 T81A possibly damaging Het
Olfr203 T A 16: 59,303,403 N84K probably benign Het
Olfr272 A T 4: 52,911,397 Y132* probably null Het
Orm3 A G 4: 63,356,909 probably null Het
Phf2 A G 13: 48,803,603 L1096P probably damaging Het
Phf2 G C 13: 48,832,103 T67S unknown Het
Pigt T C 2: 164,507,403 V542A probably damaging Het
Pnpla7 T C 2: 25,047,708 F992L probably benign Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Pramef6 A G 4: 143,895,693 M364T probably benign Het
Prmt7 A G 8: 106,237,382 T303A probably benign Het
Prpf4b A T 13: 34,894,443 I679F possibly damaging Het
Psd4 T A 2: 24,403,280 M719K probably benign Het
Ranbp9 A T 13: 43,425,117 M160K probably benign Het
Rfc1 A G 5: 65,277,363 Y687H probably damaging Het
Rimbp2 T C 5: 128,806,359 K119R probably damaging Het
Rnf113a1 T C X: 37,191,393 M1T probably null Het
Rnf40 A C 7: 127,596,334 K511Q possibly damaging Het
Ryr2 T A 13: 11,785,143 probably null Het
Scrib A T 15: 76,065,162 V365E probably damaging Het
Spta1 A G 1: 174,240,166 N2053S possibly damaging Het
Ssbp2 G A 13: 91,642,392 probably null Het
Stab1 G T 14: 31,160,499 N460K probably benign Het
Tbc1d9 T A 8: 83,266,158 C964S probably benign Het
Tmed11 A G 5: 108,779,814 probably null Het
Tmem191c C A 16: 17,278,120 R285S probably damaging Het
Tpr T C 1: 150,436,801 S1917P probably benign Het
Vill A T 9: 119,063,372 H357L probably benign Het
Vmn1r229 A G 17: 20,814,789 T99A probably benign Het
Vmn2r14 A G 5: 109,221,417 S97P probably damaging Het
Wasf2 G T 4: 133,190,172 R194L unknown Het
Other mutations in Slc6a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Slc6a17 APN 3 107493177 missense possibly damaging 0.56
IGL02514:Slc6a17 APN 3 107495677 missense possibly damaging 0.94
IGL03395:Slc6a17 APN 3 107477306 missense probably damaging 1.00
R0454:Slc6a17 UTSW 3 107476867 missense probably benign 0.12
R1201:Slc6a17 UTSW 3 107493072 missense possibly damaging 0.90
R1681:Slc6a17 UTSW 3 107474386 missense probably damaging 1.00
R1721:Slc6a17 UTSW 3 107472176 missense probably damaging 1.00
R1765:Slc6a17 UTSW 3 107473579 missense possibly damaging 0.95
R1867:Slc6a17 UTSW 3 107472176 missense probably damaging 1.00
R2167:Slc6a17 UTSW 3 107491501 nonsense probably null
R3708:Slc6a17 UTSW 3 107493085 missense probably benign
R3814:Slc6a17 UTSW 3 107471317 missense possibly damaging 0.92
R4639:Slc6a17 UTSW 3 107474281 missense probably benign
R4807:Slc6a17 UTSW 3 107500487 missense possibly damaging 0.90
R5048:Slc6a17 UTSW 3 107471437 nonsense probably null
R6076:Slc6a17 UTSW 3 107472071 missense possibly damaging 0.67
R6326:Slc6a17 UTSW 3 107500406 missense probably damaging 0.98
R6713:Slc6a17 UTSW 3 107471387 missense probably benign 0.00
R7073:Slc6a17 UTSW 3 107471439 missense not run
R7097:Slc6a17 UTSW 3 107493148 missense not run
X0010:Slc6a17 UTSW 3 107493106 missense probably benign 0.05
X0062:Slc6a17 UTSW 3 107500368 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CAAGACCTGTTACAGAGGAGCTGC -3'
(R):5'- CTGGAGATCACAGAACACTGAAGGC -3'

Sequencing Primer
(F):5'- GAGCTGCGCTAGGAAGC -3'
(R):5'- CAGAACACTGAAGGCAAAGGC -3'
Posted On2014-04-13