Incidental Mutation 'R1551:Clcn6'
ID169909
Institutional Source Beutler Lab
Gene Symbol Clcn6
Ensembl Gene ENSMUSG00000029016
Gene Namechloride channel, voltage-sensitive 6
Synonyms
MMRRC Submission 039590-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1551 (G1)
Quality Score137
Status Not validated
Chromosome4
Chromosomal Location148004259-148038821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 148012778 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 611 (P611S)
Ref Sequence ENSEMBL: ENSMUSP00000121751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030879] [ENSMUST00000105711] [ENSMUST00000137724]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030879
AA Change: P608S

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030879
Gene: ENSMUSG00000029016
AA Change: P608S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 138 571 5.5e-98 PFAM
CBS 609 658 1.68e-3 SMART
CBS 811 859 1.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105711
AA Change: P611S

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101336
Gene: ENSMUSG00000029016
AA Change: P611S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 141 574 1.5e-98 PFAM
CBS 612 661 1.68e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137724
AA Change: P611S

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121751
Gene: ENSMUSG00000029016
AA Change: P611S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 141 574 1.9e-101 PFAM
CBS 612 661 1.68e-3 SMART
CBS 814 862 1.34e-11 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 83.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ClC chloride channel and transporter family of proteins. The encoded protein may function as a vesicular Cl-/H+ antiporter. Homozygous knockout mice exhibit decreased pain sensitivity, behavioral abnormalities and features of lysosomal storage disease. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired nociception, mild behavioral abnormalities, and a progressive neuropathy of the central and peripheral nervous systems with features of neuronal ceroid lipofuscinosis (a lysosomal storage disease). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,318,878 I1534M probably benign Het
Acad11 G A 9: 104,126,586 A626T probably damaging Het
Akap9 T A 5: 4,069,174 N3560K probably benign Het
Aldh3a2 C T 11: 61,253,644 V363I probably benign Het
Anks1b A G 10: 90,076,981 T289A probably benign Het
Atp11a A G 8: 12,812,340 N64S probably damaging Het
Atp11c T C X: 60,236,712 probably null Het
Cd101 T C 3: 101,012,013 H591R probably damaging Het
Cd36 C T 5: 17,797,122 V294I probably benign Het
Cgref1 T C 5: 30,933,585 E295G probably benign Het
Cit A G 5: 115,945,842 M787V probably benign Het
Clec12a A C 6: 129,350,421 M1L probably damaging Het
Cmtm6 C T 9: 114,746,505 R161W probably damaging Het
Colec10 G T 15: 54,462,262 V163L probably damaging Het
Coq8b A G 7: 27,257,482 Y520C probably damaging Het
Ctsll3 C A 13: 60,801,007 E45* probably null Het
Dsg3 A G 18: 20,536,918 E663G possibly damaging Het
Dst G A 1: 34,192,212 R2962H probably benign Het
Etnk2 T C 1: 133,373,257 I254T probably damaging Het
Fbxo36 T C 1: 84,881,114 I40T probably damaging Het
Fgd2 G A 17: 29,378,409 V568M probably damaging Het
Fmn1 T C 2: 113,525,862 Y883H possibly damaging Het
Fpr-rs4 A T 17: 18,022,327 T199S possibly damaging Het
Gm12789 A G 4: 101,988,934 K131E probably benign Het
Gm17641 C A 3: 68,870,115 silent Het
Gm6665 G T 18: 31,820,287 R43S probably damaging Het
Gm7173 C A X: 79,488,645 L842F probably damaging Het
Gzmc T A 14: 56,232,746 H98L probably damaging Het
Hecw1 T A 13: 14,316,943 E75V probably damaging Het
Herc2 G T 7: 56,146,669 V1930L probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Htr6 A T 4: 139,074,465 C99* probably null Het
Lgals2 C T 15: 78,852,311 M16I probably benign Het
Lrrc8c A G 5: 105,608,224 N622D probably damaging Het
Myo15 A T 11: 60,492,965 I1613F possibly damaging Het
Oacyl C T 18: 65,742,209 R455C probably benign Het
Olfr1323 T C X: 50,009,995 T81A possibly damaging Het
Olfr203 T A 16: 59,303,403 N84K probably benign Het
Olfr272 A T 4: 52,911,397 Y132* probably null Het
Orm3 A G 4: 63,356,909 probably null Het
Phf2 A G 13: 48,803,603 L1096P probably damaging Het
Phf2 G C 13: 48,832,103 T67S unknown Het
Pigt T C 2: 164,507,403 V542A probably damaging Het
Pnpla7 T C 2: 25,047,708 F992L probably benign Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Pramef6 A G 4: 143,895,693 M364T probably benign Het
Prmt7 A G 8: 106,237,382 T303A probably benign Het
Prpf4b A T 13: 34,894,443 I679F possibly damaging Het
Psd4 T A 2: 24,403,280 M719K probably benign Het
Ranbp9 A T 13: 43,425,117 M160K probably benign Het
Rfc1 A G 5: 65,277,363 Y687H probably damaging Het
Rimbp2 T C 5: 128,806,359 K119R probably damaging Het
Rnf113a1 T C X: 37,191,393 M1T probably null Het
Rnf40 A C 7: 127,596,334 K511Q possibly damaging Het
Ryr2 T A 13: 11,785,143 probably null Het
Scrib A T 15: 76,065,162 V365E probably damaging Het
Slc6a17 A G 3: 107,472,127 V575A possibly damaging Het
Spta1 A G 1: 174,240,166 N2053S possibly damaging Het
Ssbp2 G A 13: 91,642,392 probably null Het
Stab1 G T 14: 31,160,499 N460K probably benign Het
Tbc1d9 T A 8: 83,266,158 C964S probably benign Het
Tmed11 A G 5: 108,779,814 probably null Het
Tmem191c C A 16: 17,278,120 R285S probably damaging Het
Tpr T C 1: 150,436,801 S1917P probably benign Het
Vill A T 9: 119,063,372 H357L probably benign Het
Vmn1r229 A G 17: 20,814,789 T99A probably benign Het
Vmn2r14 A G 5: 109,221,417 S97P probably damaging Het
Wasf2 G T 4: 133,190,172 R194L unknown Het
Other mutations in Clcn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Clcn6 APN 4 148017902 critical splice donor site probably null
IGL00434:Clcn6 APN 4 148013738 missense probably damaging 1.00
IGL00973:Clcn6 APN 4 148013788 splice site probably benign
IGL01384:Clcn6 APN 4 148018966 missense probably damaging 1.00
IGL01465:Clcn6 APN 4 148021451 splice site probably benign
IGL01522:Clcn6 APN 4 148017535 missense probably benign 0.44
R0194:Clcn6 UTSW 4 148012756 missense probably damaging 1.00
R0280:Clcn6 UTSW 4 148008715 missense probably damaging 1.00
R0349:Clcn6 UTSW 4 148024194 missense possibly damaging 0.89
R0352:Clcn6 UTSW 4 148014606 missense probably damaging 1.00
R0586:Clcn6 UTSW 4 148038749 unclassified probably benign
R0927:Clcn6 UTSW 4 148029392 missense probably benign 0.30
R1141:Clcn6 UTSW 4 148013899 missense probably damaging 0.99
R1465:Clcn6 UTSW 4 148013901 missense probably damaging 1.00
R1465:Clcn6 UTSW 4 148013901 missense probably damaging 1.00
R1473:Clcn6 UTSW 4 148024156 missense possibly damaging 0.93
R1571:Clcn6 UTSW 4 148012769 missense possibly damaging 0.63
R1593:Clcn6 UTSW 4 148014594 missense probably benign
R1596:Clcn6 UTSW 4 148023379 missense probably damaging 1.00
R1706:Clcn6 UTSW 4 148017568 missense probably benign 0.00
R1769:Clcn6 UTSW 4 148014301 intron probably null
R2021:Clcn6 UTSW 4 148010652 critical splice donor site probably null
R2022:Clcn6 UTSW 4 148010652 critical splice donor site probably null
R2049:Clcn6 UTSW 4 148024137 missense possibly damaging 0.88
R2081:Clcn6 UTSW 4 148011068 missense probably damaging 1.00
R2140:Clcn6 UTSW 4 148024137 missense possibly damaging 0.88
R2141:Clcn6 UTSW 4 148024137 missense possibly damaging 0.88
R2142:Clcn6 UTSW 4 148024137 missense possibly damaging 0.88
R2177:Clcn6 UTSW 4 148014600 missense possibly damaging 0.73
R2511:Clcn6 UTSW 4 148017494 critical splice donor site probably null
R2891:Clcn6 UTSW 4 148012616 critical splice donor site probably null
R3750:Clcn6 UTSW 4 148024187 nonsense probably null
R4014:Clcn6 UTSW 4 148017610 missense probably damaging 0.98
R4023:Clcn6 UTSW 4 148014283 missense possibly damaging 0.91
R4024:Clcn6 UTSW 4 148014283 missense possibly damaging 0.91
R4025:Clcn6 UTSW 4 148014283 missense possibly damaging 0.91
R4667:Clcn6 UTSW 4 148024167 missense possibly damaging 0.61
R4865:Clcn6 UTSW 4 148019766 missense probably damaging 1.00
R4978:Clcn6 UTSW 4 148008770 missense probably benign 0.05
R5140:Clcn6 UTSW 4 148038317 unclassified probably benign
R5345:Clcn6 UTSW 4 148038749 unclassified probably benign
R5467:Clcn6 UTSW 4 148017636 missense possibly damaging 0.81
R5665:Clcn6 UTSW 4 148014561 missense possibly damaging 0.71
R5739:Clcn6 UTSW 4 148014189 missense probably damaging 1.00
R5899:Clcn6 UTSW 4 148017592 missense probably benign 0.01
R6043:Clcn6 UTSW 4 148008788 missense probably damaging 1.00
R6351:Clcn6 UTSW 4 148017500 missense probably benign 0.01
R6593:Clcn6 UTSW 4 148010769 missense probably benign 0.21
V7732:Clcn6 UTSW 4 148013955 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCAGCTTCAGAGGCAGCATTACAC -3'
(R):5'- AGGGCTCCAGAATTGCCCTTTCAC -3'

Sequencing Primer
(F):5'- CATTACACAGCCTGAGTGTTGG -3'
(R):5'- CCCCGAGCATGATGAAGTG -3'
Posted On2014-04-13