Incidental Mutation 'R1551:Cd36'
ID169912
Institutional Source Beutler Lab
Gene Symbol Cd36
Ensembl Gene ENSMUSG00000002944
Gene NameCD36 molecule
Synonymsfatty acid translocase, FAT, Scarb3
MMRRC Submission 039590-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R1551 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location17781690-17888801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 17797122 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 294 (V294I)
Ref Sequence ENSEMBL: ENSMUSP00000143061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082367] [ENSMUST00000165232] [ENSMUST00000169095] [ENSMUST00000170051] [ENSMUST00000197890]
Predicted Effect probably benign
Transcript: ENSMUST00000082367
AA Change: V294I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000080974
Gene: ENSMUSG00000002944
AA Change: V294I

DomainStartEndE-ValueType
Pfam:CD36 14 463 2.5e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165232
AA Change: V294I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000126300
Gene: ENSMUSG00000002944
AA Change: V294I

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169095
AA Change: V294I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000131832
Gene: ENSMUSG00000002944
AA Change: V294I

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170051
AA Change: V294I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000133008
Gene: ENSMUSG00000002944
AA Change: V294I

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197890
AA Change: V294I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000143061
Gene: ENSMUSG00000002944
AA Change: V294I

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 83.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the fourth major glycoprotein of the platelet surface and serves as a receptor for thrombospondin in platelets and various cell lines. Since thrombospondins are widely distributed proteins involved in a variety of adhesive processes, this protein may have important functions as a cell adhesion molecule. It binds to collagen, thrombospondin, anionic phospholipids and oxidized LDL. It directly mediates cytoadherence of Plasmodium falciparum parasitized erythrocytes and it binds long chain fatty acids and may function in the transport and/or as a regulator of fatty acid transport. Mutations in this gene cause platelet glycoprotein deficiency. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice exhibit an immunodeficiency phenotype, are susceptible to S. aureus infection and develop ocular pterygium. Mice homozygous for disruptions in this gene display abnormal lipid homeostasis which affects energy utilization in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,318,878 I1534M probably benign Het
Acad11 G A 9: 104,126,586 A626T probably damaging Het
Akap9 T A 5: 4,069,174 N3560K probably benign Het
Aldh3a2 C T 11: 61,253,644 V363I probably benign Het
Anks1b A G 10: 90,076,981 T289A probably benign Het
Atp11a A G 8: 12,812,340 N64S probably damaging Het
Atp11c T C X: 60,236,712 probably null Het
Cd101 T C 3: 101,012,013 H591R probably damaging Het
Cgref1 T C 5: 30,933,585 E295G probably benign Het
Cit A G 5: 115,945,842 M787V probably benign Het
Clcn6 G A 4: 148,012,778 P611S possibly damaging Het
Clec12a A C 6: 129,350,421 M1L probably damaging Het
Cmtm6 C T 9: 114,746,505 R161W probably damaging Het
Colec10 G T 15: 54,462,262 V163L probably damaging Het
Coq8b A G 7: 27,257,482 Y520C probably damaging Het
Ctsll3 C A 13: 60,801,007 E45* probably null Het
Dsg3 A G 18: 20,536,918 E663G possibly damaging Het
Dst G A 1: 34,192,212 R2962H probably benign Het
Etnk2 T C 1: 133,373,257 I254T probably damaging Het
Fbxo36 T C 1: 84,881,114 I40T probably damaging Het
Fgd2 G A 17: 29,378,409 V568M probably damaging Het
Fmn1 T C 2: 113,525,862 Y883H possibly damaging Het
Fpr-rs4 A T 17: 18,022,327 T199S possibly damaging Het
Gm12789 A G 4: 101,988,934 K131E probably benign Het
Gm17641 C A 3: 68,870,115 silent Het
Gm6665 G T 18: 31,820,287 R43S probably damaging Het
Gm7173 C A X: 79,488,645 L842F probably damaging Het
Gzmc T A 14: 56,232,746 H98L probably damaging Het
Hecw1 T A 13: 14,316,943 E75V probably damaging Het
Herc2 G T 7: 56,146,669 V1930L probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Htr6 A T 4: 139,074,465 C99* probably null Het
Lgals2 C T 15: 78,852,311 M16I probably benign Het
Lrrc8c A G 5: 105,608,224 N622D probably damaging Het
Myo15 A T 11: 60,492,965 I1613F possibly damaging Het
Oacyl C T 18: 65,742,209 R455C probably benign Het
Olfr1323 T C X: 50,009,995 T81A possibly damaging Het
Olfr203 T A 16: 59,303,403 N84K probably benign Het
Olfr272 A T 4: 52,911,397 Y132* probably null Het
Orm3 A G 4: 63,356,909 probably null Het
Phf2 A G 13: 48,803,603 L1096P probably damaging Het
Phf2 G C 13: 48,832,103 T67S unknown Het
Pigt T C 2: 164,507,403 V542A probably damaging Het
Pnpla7 T C 2: 25,047,708 F992L probably benign Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Pramef6 A G 4: 143,895,693 M364T probably benign Het
Prmt7 A G 8: 106,237,382 T303A probably benign Het
Prpf4b A T 13: 34,894,443 I679F possibly damaging Het
Psd4 T A 2: 24,403,280 M719K probably benign Het
Ranbp9 A T 13: 43,425,117 M160K probably benign Het
Rfc1 A G 5: 65,277,363 Y687H probably damaging Het
Rimbp2 T C 5: 128,806,359 K119R probably damaging Het
Rnf113a1 T C X: 37,191,393 M1T probably null Het
Rnf40 A C 7: 127,596,334 K511Q possibly damaging Het
Ryr2 T A 13: 11,785,143 probably null Het
Scrib A T 15: 76,065,162 V365E probably damaging Het
Slc6a17 A G 3: 107,472,127 V575A possibly damaging Het
Spta1 A G 1: 174,240,166 N2053S possibly damaging Het
Ssbp2 G A 13: 91,642,392 probably null Het
Stab1 G T 14: 31,160,499 N460K probably benign Het
Tbc1d9 T A 8: 83,266,158 C964S probably benign Het
Tmed11 A G 5: 108,779,814 probably null Het
Tmem191c C A 16: 17,278,120 R285S probably damaging Het
Tpr T C 1: 150,436,801 S1917P probably benign Het
Vill A T 9: 119,063,372 H357L probably benign Het
Vmn1r229 A G 17: 20,814,789 T99A probably benign Het
Vmn2r14 A G 5: 109,221,417 S97P probably damaging Het
Wasf2 G T 4: 133,190,172 R194L unknown Het
Other mutations in Cd36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Cd36 APN 5 17787702 missense probably damaging 0.99
IGL01355:Cd36 APN 5 17813074 missense possibly damaging 0.76
IGL02140:Cd36 APN 5 17828768 splice site probably benign
IGL02385:Cd36 APN 5 17814719 missense probably benign 0.31
IGL02626:Cd36 APN 5 17797128 nonsense probably null
IGL02645:Cd36 APN 5 17785880 missense probably benign 0.01
IGL03149:Cd36 APN 5 17820565 missense probably benign 0.02
detached UTSW 5 17814723 missense probably damaging 1.00
oblivious UTSW 5 17874966 intron probably benign
E0370:Cd36 UTSW 5 17785749 nonsense probably null
F5770:Cd36 UTSW 5 17820528 frame shift probably null
R0266:Cd36 UTSW 5 17798252 missense probably benign 0.09
R1102:Cd36 UTSW 5 17814213 missense possibly damaging 0.79
R1120:Cd36 UTSW 5 17785828 missense possibly damaging 0.67
R1170:Cd36 UTSW 5 17813088 missense probably damaging 1.00
R1918:Cd36 UTSW 5 17797036 nonsense probably null
R4090:Cd36 UTSW 5 17785720 critical splice donor site probably null
R4197:Cd36 UTSW 5 17813088 missense probably damaging 1.00
R5602:Cd36 UTSW 5 17814792 missense possibly damaging 0.94
R5647:Cd36 UTSW 5 17814765 missense probably damaging 1.00
R5867:Cd36 UTSW 5 17785735 missense probably benign 0.05
R6151:Cd36 UTSW 5 17795595 missense probably damaging 1.00
R6400:Cd36 UTSW 5 17814723 missense probably damaging 1.00
R6419:Cd36 UTSW 5 17797152 missense probably benign
R7081:Cd36 UTSW 5 17814704 missense not run
V7580:Cd36 UTSW 5 17820528 frame shift probably null
Z1088:Cd36 UTSW 5 17795575 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACTAACTCTTTCCCAGCTTAAGGTCTCT -3'
(R):5'- TCTGCTCCAAGCCCACCATGTA -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- CATATTCCAGCAAGTGAGTAGC -3'
Posted On2014-04-13