Incidental Mutation 'R1551:Lrrc8c'
ID169915
Institutional Source Beutler Lab
Gene Symbol Lrrc8c
Ensembl Gene ENSMUSG00000054720
Gene Nameleucine rich repeat containing 8 family, member C
SynonymsE430036I04Rik
MMRRC Submission 039590-MU
Accession Numbers

NCBI RefSeq: NM_133897.2; MGI:2140839

Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R1551 (G1)
Quality Score210
Status Not validated
Chromosome5
Chromosomal Location105519388-105613018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105608224 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 622 (N622D)
Ref Sequence ENSEMBL: ENSMUSP00000066015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067924] [ENSMUST00000153754]
Predicted Effect probably damaging
Transcript: ENSMUST00000067924
AA Change: N622D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066015
Gene: ENSMUSG00000054720
AA Change: N622D

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 338 5.7e-152 PFAM
low complexity region 398 407 N/A INTRINSIC
LRR 588 611 3.97e0 SMART
LRR 613 635 1.81e2 SMART
LRR 636 658 2.2e1 SMART
LRR_TYP 659 682 1.45e-2 SMART
LRR 684 703 3.56e2 SMART
LRR 705 728 2.92e1 SMART
LRR 751 774 1.09e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153754
SMART Domains Protein: ENSMUSP00000114899
Gene: ENSMUSG00000054720

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 4.8e-35 PFAM
low complexity region 78 93 N/A INTRINSIC
Pfam:DUF3733 99 158 1.7e-26 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 83.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in body weight, white adipose tissue weight, and insulin resistance on a high-fat diet, indicating protection from diet-induced obesity and insulin resistance. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,318,878 I1534M probably benign Het
Acad11 G A 9: 104,126,586 A626T probably damaging Het
Akap9 T A 5: 4,069,174 N3560K probably benign Het
Aldh3a2 C T 11: 61,253,644 V363I probably benign Het
Anks1b A G 10: 90,076,981 T289A probably benign Het
Atp11a A G 8: 12,812,340 N64S probably damaging Het
Atp11c T C X: 60,236,712 probably null Het
Cd101 T C 3: 101,012,013 H591R probably damaging Het
Cd36 C T 5: 17,797,122 V294I probably benign Het
Cgref1 T C 5: 30,933,585 E295G probably benign Het
Cit A G 5: 115,945,842 M787V probably benign Het
Clcn6 G A 4: 148,012,778 P611S possibly damaging Het
Clec12a A C 6: 129,350,421 M1L probably damaging Het
Cmtm6 C T 9: 114,746,505 R161W probably damaging Het
Colec10 G T 15: 54,462,262 V163L probably damaging Het
Coq8b A G 7: 27,257,482 Y520C probably damaging Het
Ctsll3 C A 13: 60,801,007 E45* probably null Het
Dsg3 A G 18: 20,536,918 E663G possibly damaging Het
Dst G A 1: 34,192,212 R2962H probably benign Het
Etnk2 T C 1: 133,373,257 I254T probably damaging Het
Fbxo36 T C 1: 84,881,114 I40T probably damaging Het
Fgd2 G A 17: 29,378,409 V568M probably damaging Het
Fmn1 T C 2: 113,525,862 Y883H possibly damaging Het
Fpr-rs4 A T 17: 18,022,327 T199S possibly damaging Het
Gm12789 A G 4: 101,988,934 K131E probably benign Het
Gm17641 C A 3: 68,870,115 silent Het
Gm6665 G T 18: 31,820,287 R43S probably damaging Het
Gm7173 C A X: 79,488,645 L842F probably damaging Het
Gzmc T A 14: 56,232,746 H98L probably damaging Het
Hecw1 T A 13: 14,316,943 E75V probably damaging Het
Herc2 G T 7: 56,146,669 V1930L probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Htr6 A T 4: 139,074,465 C99* probably null Het
Lgals2 C T 15: 78,852,311 M16I probably benign Het
Myo15 A T 11: 60,492,965 I1613F possibly damaging Het
Oacyl C T 18: 65,742,209 R455C probably benign Het
Olfr1323 T C X: 50,009,995 T81A possibly damaging Het
Olfr203 T A 16: 59,303,403 N84K probably benign Het
Olfr272 A T 4: 52,911,397 Y132* probably null Het
Orm3 A G 4: 63,356,909 probably null Het
Phf2 A G 13: 48,803,603 L1096P probably damaging Het
Phf2 G C 13: 48,832,103 T67S unknown Het
Pigt T C 2: 164,507,403 V542A probably damaging Het
Pnpla7 T C 2: 25,047,708 F992L probably benign Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Pramef6 A G 4: 143,895,693 M364T probably benign Het
Prmt7 A G 8: 106,237,382 T303A probably benign Het
Prpf4b A T 13: 34,894,443 I679F possibly damaging Het
Psd4 T A 2: 24,403,280 M719K probably benign Het
Ranbp9 A T 13: 43,425,117 M160K probably benign Het
Rfc1 A G 5: 65,277,363 Y687H probably damaging Het
Rimbp2 T C 5: 128,806,359 K119R probably damaging Het
Rnf113a1 T C X: 37,191,393 M1T probably null Het
Rnf40 A C 7: 127,596,334 K511Q possibly damaging Het
Ryr2 T A 13: 11,785,143 probably null Het
Scrib A T 15: 76,065,162 V365E probably damaging Het
Slc6a17 A G 3: 107,472,127 V575A possibly damaging Het
Spta1 A G 1: 174,240,166 N2053S possibly damaging Het
Ssbp2 G A 13: 91,642,392 probably null Het
Stab1 G T 14: 31,160,499 N460K probably benign Het
Tbc1d9 T A 8: 83,266,158 C964S probably benign Het
Tmed11 A G 5: 108,779,814 probably null Het
Tmem191c C A 16: 17,278,120 R285S probably damaging Het
Tpr T C 1: 150,436,801 S1917P probably benign Het
Vill A T 9: 119,063,372 H357L probably benign Het
Vmn1r229 A G 17: 20,814,789 T99A probably benign Het
Vmn2r14 A G 5: 109,221,417 S97P probably damaging Het
Wasf2 G T 4: 133,190,172 R194L unknown Het
Other mutations in Lrrc8c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Lrrc8c APN 5 105607210 missense probably damaging 0.99
IGL00736:Lrrc8c APN 5 105607114 missense probably damaging 1.00
IGL00822:Lrrc8c APN 5 105608308 missense probably benign 0.04
IGL02009:Lrrc8c APN 5 105607391 missense probably damaging 1.00
IGL02156:Lrrc8c APN 5 105607493 missense probably damaging 1.00
IGL02266:Lrrc8c APN 5 105608248 missense probably benign 0.30
IGL02268:Lrrc8c APN 5 105607898 missense probably damaging 1.00
IGL02487:Lrrc8c APN 5 105606591 missense probably benign
IGL02536:Lrrc8c APN 5 105607172 missense probably benign 0.00
IGL02672:Lrrc8c APN 5 105607358 missense possibly damaging 0.85
IGL02860:Lrrc8c APN 5 105579615 splice site probably benign
IGL03395:Lrrc8c APN 5 105606629 missense probably benign
P0014:Lrrc8c UTSW 5 105607244 missense probably benign 0.06
R0196:Lrrc8c UTSW 5 105606770 missense probably benign 0.18
R0454:Lrrc8c UTSW 5 105607099 missense probably damaging 1.00
R0565:Lrrc8c UTSW 5 105607028 missense probably damaging 0.98
R0673:Lrrc8c UTSW 5 105607678 missense probably damaging 0.99
R0722:Lrrc8c UTSW 5 105579548 missense probably damaging 1.00
R0815:Lrrc8c UTSW 5 105608534 missense probably damaging 1.00
R1177:Lrrc8c UTSW 5 105606836 missense probably benign 0.40
R1411:Lrrc8c UTSW 5 105608179 missense probably damaging 0.96
R1486:Lrrc8c UTSW 5 105607529 missense probably damaging 1.00
R1662:Lrrc8c UTSW 5 105606757 missense probably benign 0.22
R1714:Lrrc8c UTSW 5 105607291 missense possibly damaging 0.93
R1770:Lrrc8c UTSW 5 105606737 missense probably damaging 1.00
R2104:Lrrc8c UTSW 5 105607358 missense possibly damaging 0.85
R2139:Lrrc8c UTSW 5 105606692 missense probably damaging 1.00
R4425:Lrrc8c UTSW 5 105607889 missense probably benign 0.22
R4670:Lrrc8c UTSW 5 105608374 missense probably benign
R4897:Lrrc8c UTSW 5 105608089 missense probably benign 0.01
R4968:Lrrc8c UTSW 5 105607127 missense probably damaging 1.00
R5114:Lrrc8c UTSW 5 105607483 missense probably damaging 1.00
R5580:Lrrc8c UTSW 5 105607687 missense probably benign 0.00
R5804:Lrrc8c UTSW 5 105579557 missense possibly damaging 0.88
R5918:Lrrc8c UTSW 5 105608251 missense possibly damaging 0.68
R6293:Lrrc8c UTSW 5 105606746 missense probably damaging 1.00
R6303:Lrrc8c UTSW 5 105608609 missense probably benign 0.31
R6304:Lrrc8c UTSW 5 105608609 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CGTCCACAATGATGGCACCAAACTG -3'
(R):5'- TCTGGGAGGCTCTCCACTTTGTTAC -3'

Sequencing Primer
(F):5'- TGGTGATGCTCAACAACCTG -3'
(R):5'- TGTCGTTATAGGACAAGTCCAG -3'
Posted On2014-04-13