Incidental Mutation 'R1551:Vmn2r14'
ID169917
Institutional Source Beutler Lab
Gene Symbol Vmn2r14
Ensembl Gene ENSMUSG00000091059
Gene Namevomeronasal 2, receptor 14
SynonymsEG231591
MMRRC Submission 039590-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R1551 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location109215502-109224622 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109221417 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 97 (S97P)
Ref Sequence ENSEMBL: ENSMUSP00000128015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170341]
Predicted Effect probably damaging
Transcript: ENSMUST00000170341
AA Change: S97P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128015
Gene: ENSMUSG00000091059
AA Change: S97P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.3e-31 PFAM
Pfam:NCD3G 507 561 1.1e-17 PFAM
Pfam:7tm_3 594 829 1.2e-55 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 83.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,318,878 I1534M probably benign Het
Acad11 G A 9: 104,126,586 A626T probably damaging Het
Akap9 T A 5: 4,069,174 N3560K probably benign Het
Aldh3a2 C T 11: 61,253,644 V363I probably benign Het
Anks1b A G 10: 90,076,981 T289A probably benign Het
Atp11a A G 8: 12,812,340 N64S probably damaging Het
Atp11c T C X: 60,236,712 probably null Het
Cd101 T C 3: 101,012,013 H591R probably damaging Het
Cd36 C T 5: 17,797,122 V294I probably benign Het
Cgref1 T C 5: 30,933,585 E295G probably benign Het
Cit A G 5: 115,945,842 M787V probably benign Het
Clcn6 G A 4: 148,012,778 P611S possibly damaging Het
Clec12a A C 6: 129,350,421 M1L probably damaging Het
Cmtm6 C T 9: 114,746,505 R161W probably damaging Het
Colec10 G T 15: 54,462,262 V163L probably damaging Het
Coq8b A G 7: 27,257,482 Y520C probably damaging Het
Ctsll3 C A 13: 60,801,007 E45* probably null Het
Dsg3 A G 18: 20,536,918 E663G possibly damaging Het
Dst G A 1: 34,192,212 R2962H probably benign Het
Etnk2 T C 1: 133,373,257 I254T probably damaging Het
Fbxo36 T C 1: 84,881,114 I40T probably damaging Het
Fgd2 G A 17: 29,378,409 V568M probably damaging Het
Fmn1 T C 2: 113,525,862 Y883H possibly damaging Het
Fpr-rs4 A T 17: 18,022,327 T199S possibly damaging Het
Gm12789 A G 4: 101,988,934 K131E probably benign Het
Gm17641 C A 3: 68,870,115 silent Het
Gm6665 G T 18: 31,820,287 R43S probably damaging Het
Gm7173 C A X: 79,488,645 L842F probably damaging Het
Gzmc T A 14: 56,232,746 H98L probably damaging Het
Hecw1 T A 13: 14,316,943 E75V probably damaging Het
Herc2 G T 7: 56,146,669 V1930L probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Htr6 A T 4: 139,074,465 C99* probably null Het
Lgals2 C T 15: 78,852,311 M16I probably benign Het
Lrrc8c A G 5: 105,608,224 N622D probably damaging Het
Myo15 A T 11: 60,492,965 I1613F possibly damaging Het
Oacyl C T 18: 65,742,209 R455C probably benign Het
Olfr1323 T C X: 50,009,995 T81A possibly damaging Het
Olfr203 T A 16: 59,303,403 N84K probably benign Het
Olfr272 A T 4: 52,911,397 Y132* probably null Het
Orm3 A G 4: 63,356,909 probably null Het
Phf2 A G 13: 48,803,603 L1096P probably damaging Het
Phf2 G C 13: 48,832,103 T67S unknown Het
Pigt T C 2: 164,507,403 V542A probably damaging Het
Pnpla7 T C 2: 25,047,708 F992L probably benign Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Pramef6 A G 4: 143,895,693 M364T probably benign Het
Prmt7 A G 8: 106,237,382 T303A probably benign Het
Prpf4b A T 13: 34,894,443 I679F possibly damaging Het
Psd4 T A 2: 24,403,280 M719K probably benign Het
Ranbp9 A T 13: 43,425,117 M160K probably benign Het
Rfc1 A G 5: 65,277,363 Y687H probably damaging Het
Rimbp2 T C 5: 128,806,359 K119R probably damaging Het
Rnf113a1 T C X: 37,191,393 M1T probably null Het
Rnf40 A C 7: 127,596,334 K511Q possibly damaging Het
Ryr2 T A 13: 11,785,143 probably null Het
Scrib A T 15: 76,065,162 V365E probably damaging Het
Slc6a17 A G 3: 107,472,127 V575A possibly damaging Het
Spta1 A G 1: 174,240,166 N2053S possibly damaging Het
Ssbp2 G A 13: 91,642,392 probably null Het
Stab1 G T 14: 31,160,499 N460K probably benign Het
Tbc1d9 T A 8: 83,266,158 C964S probably benign Het
Tmed11 A G 5: 108,779,814 probably null Het
Tmem191c C A 16: 17,278,120 R285S probably damaging Het
Tpr T C 1: 150,436,801 S1917P probably benign Het
Vill A T 9: 119,063,372 H357L probably benign Het
Vmn1r229 A G 17: 20,814,789 T99A probably benign Het
Wasf2 G T 4: 133,190,172 R194L unknown Het
Other mutations in Vmn2r14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Vmn2r14 APN 5 109216314 nonsense probably null
IGL01504:Vmn2r14 APN 5 109221419 missense probably benign 0.01
IGL01828:Vmn2r14 APN 5 109224577 missense possibly damaging 0.71
IGL02093:Vmn2r14 APN 5 109220409 missense possibly damaging 0.94
IGL02103:Vmn2r14 APN 5 109224483 missense probably damaging 0.96
IGL02123:Vmn2r14 APN 5 109220067 missense probably damaging 1.00
IGL02145:Vmn2r14 APN 5 109220588 nonsense probably null
IGL02676:Vmn2r14 APN 5 109220016 missense probably benign 0.03
IGL02720:Vmn2r14 APN 5 109221439 missense probably damaging 1.00
IGL02877:Vmn2r14 APN 5 109220188 missense probably damaging 0.99
IGL02974:Vmn2r14 APN 5 109221426 missense possibly damaging 0.55
IGL03151:Vmn2r14 APN 5 109216394 missense probably damaging 1.00
IGL03297:Vmn2r14 APN 5 109216107 missense probably damaging 1.00
IGL03386:Vmn2r14 APN 5 109220484 missense possibly damaging 0.90
IGL03394:Vmn2r14 APN 5 109219836 missense probably null 0.83
ANU74:Vmn2r14 UTSW 5 109219044 missense probably benign 0.00
R0316:Vmn2r14 UTSW 5 109218896 missense probably benign 0.07
R0755:Vmn2r14 UTSW 5 109216360 missense possibly damaging 0.81
R1219:Vmn2r14 UTSW 5 109224574 missense probably benign 0.17
R1321:Vmn2r14 UTSW 5 109216251 missense probably benign 0.08
R1465:Vmn2r14 UTSW 5 109220329 missense possibly damaging 0.47
R1465:Vmn2r14 UTSW 5 109220329 missense possibly damaging 0.47
R1509:Vmn2r14 UTSW 5 109215996 missense probably benign 0.00
R1628:Vmn2r14 UTSW 5 109219972 missense probably benign 0.00
R1668:Vmn2r14 UTSW 5 109219047 nonsense probably null
R2013:Vmn2r14 UTSW 5 109221243 missense probably benign 0.00
R2201:Vmn2r14 UTSW 5 109218832 splice site probably null
R2417:Vmn2r14 UTSW 5 109224463 missense probably benign 0.00
R3029:Vmn2r14 UTSW 5 109215910 missense probably damaging 1.00
R3120:Vmn2r14 UTSW 5 109224565 missense probably null 0.00
R3729:Vmn2r14 UTSW 5 109216229 missense probably damaging 1.00
R3762:Vmn2r14 UTSW 5 109220167 missense probably benign 0.02
R3943:Vmn2r14 UTSW 5 109216064 missense probably damaging 1.00
R3944:Vmn2r14 UTSW 5 109216064 missense probably damaging 1.00
R4222:Vmn2r14 UTSW 5 109216283 missense probably benign 0.00
R4224:Vmn2r14 UTSW 5 109216283 missense probably benign 0.00
R4239:Vmn2r14 UTSW 5 109216411 critical splice acceptor site probably null
R4240:Vmn2r14 UTSW 5 109216411 critical splice acceptor site probably null
R4782:Vmn2r14 UTSW 5 109221504 missense probably benign 0.01
R4832:Vmn2r14 UTSW 5 109216110 missense probably damaging 1.00
R4884:Vmn2r14 UTSW 5 109221518 splice site probably null
R4896:Vmn2r14 UTSW 5 109220380 missense probably benign 0.19
R5004:Vmn2r14 UTSW 5 109220380 missense probably benign 0.19
R5117:Vmn2r14 UTSW 5 109216095 missense probably benign 0.16
R5285:Vmn2r14 UTSW 5 109217576 missense probably damaging 0.98
R5413:Vmn2r14 UTSW 5 109221288 missense probably benign 0.29
R5569:Vmn2r14 UTSW 5 109220395 missense probably benign 0.44
R5701:Vmn2r14 UTSW 5 109219950 missense probably damaging 1.00
R5726:Vmn2r14 UTSW 5 109217620 missense possibly damaging 0.95
R5763:Vmn2r14 UTSW 5 109215858 missense possibly damaging 0.49
R5872:Vmn2r14 UTSW 5 109221356 missense probably benign
R5985:Vmn2r14 UTSW 5 109220216 missense possibly damaging 0.89
R6268:Vmn2r14 UTSW 5 109221417 missense possibly damaging 0.87
R6273:Vmn2r14 UTSW 5 109221267 missense probably benign 0.44
R6409:Vmn2r14 UTSW 5 109216230 missense probably benign 0.09
R6944:Vmn2r14 UTSW 5 109216059 missense probably benign 0.22
R6944:Vmn2r14 UTSW 5 109216274 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACCCTTGGTGTCCCAGAATTTGTTG -3'
(R):5'- TGACCTTGGCTACACTGACTGCTC -3'

Sequencing Primer
(F):5'- GTCCCAGAATTTGTTGAGAGTTTTAC -3'
(R):5'- CTCTGACTCTCGACAGTATAAATGC -3'
Posted On2014-04-13