Incidental Mutation 'R1551:Phf2'
ID169945
Institutional Source Beutler Lab
Gene Symbol Phf2
Ensembl Gene ENSMUSG00000038025
Gene NamePHD finger protein 2
Synonyms
MMRRC Submission 039590-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.427) question?
Stock #R1551 (G1)
Quality Score148
Status Not validated
Chromosome13
Chromosomal Location48801750-48871119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 48832103 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 67 (T67S)
Ref Sequence ENSEMBL: ENSMUSP00000047308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035540]
Predicted Effect unknown
Transcript: ENSMUST00000035540
AA Change: T67S
SMART Domains Protein: ENSMUSP00000047308
Gene: ENSMUSG00000038025
AA Change: T67S

DomainStartEndE-ValueType
PHD 7 54 1.08e-9 SMART
JmjC 197 353 1.98e-47 SMART
low complexity region 468 481 N/A INTRINSIC
low complexity region 487 532 N/A INTRINSIC
low complexity region 884 891 N/A INTRINSIC
coiled coil region 924 948 N/A INTRINSIC
low complexity region 953 1021 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 83.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a zinc finger-like PHD (plant homeodomain) finger, distinct from other classes of zinc finger motifs, and a hydrophobic and highly conserved domain. The PHD finger shows the typical Cys4-His-Cys3 arrangement. PHD finger genes are thought to belong to a diverse group of transcriptional regulators possibly affecting eukaryotic gene expression by influencing chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, decreased body weight, decreased adipocity and impaired adipogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,318,878 I1534M probably benign Het
Acad11 G A 9: 104,126,586 A626T probably damaging Het
Akap9 T A 5: 4,069,174 N3560K probably benign Het
Aldh3a2 C T 11: 61,253,644 V363I probably benign Het
Anks1b A G 10: 90,076,981 T289A probably benign Het
Atp11a A G 8: 12,812,340 N64S probably damaging Het
Atp11c T C X: 60,236,712 probably null Het
Cd101 T C 3: 101,012,013 H591R probably damaging Het
Cd36 C T 5: 17,797,122 V294I probably benign Het
Cgref1 T C 5: 30,933,585 E295G probably benign Het
Cit A G 5: 115,945,842 M787V probably benign Het
Clcn6 G A 4: 148,012,778 P611S possibly damaging Het
Clec12a A C 6: 129,350,421 M1L probably damaging Het
Cmtm6 C T 9: 114,746,505 R161W probably damaging Het
Colec10 G T 15: 54,462,262 V163L probably damaging Het
Coq8b A G 7: 27,257,482 Y520C probably damaging Het
Ctsll3 C A 13: 60,801,007 E45* probably null Het
Dsg3 A G 18: 20,536,918 E663G possibly damaging Het
Dst G A 1: 34,192,212 R2962H probably benign Het
Etnk2 T C 1: 133,373,257 I254T probably damaging Het
Fbxo36 T C 1: 84,881,114 I40T probably damaging Het
Fgd2 G A 17: 29,378,409 V568M probably damaging Het
Fmn1 T C 2: 113,525,862 Y883H possibly damaging Het
Fpr-rs4 A T 17: 18,022,327 T199S possibly damaging Het
Gm12789 A G 4: 101,988,934 K131E probably benign Het
Gm17641 C A 3: 68,870,115 silent Het
Gm6665 G T 18: 31,820,287 R43S probably damaging Het
Gm7173 C A X: 79,488,645 L842F probably damaging Het
Gzmc T A 14: 56,232,746 H98L probably damaging Het
Hecw1 T A 13: 14,316,943 E75V probably damaging Het
Herc2 G T 7: 56,146,669 V1930L probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Htr6 A T 4: 139,074,465 C99* probably null Het
Lgals2 C T 15: 78,852,311 M16I probably benign Het
Lrrc8c A G 5: 105,608,224 N622D probably damaging Het
Myo15 A T 11: 60,492,965 I1613F possibly damaging Het
Oacyl C T 18: 65,742,209 R455C probably benign Het
Olfr1323 T C X: 50,009,995 T81A possibly damaging Het
Olfr203 T A 16: 59,303,403 N84K probably benign Het
Olfr272 A T 4: 52,911,397 Y132* probably null Het
Orm3 A G 4: 63,356,909 probably null Het
Pigt T C 2: 164,507,403 V542A probably damaging Het
Pnpla7 T C 2: 25,047,708 F992L probably benign Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Pramef6 A G 4: 143,895,693 M364T probably benign Het
Prmt7 A G 8: 106,237,382 T303A probably benign Het
Prpf4b A T 13: 34,894,443 I679F possibly damaging Het
Psd4 T A 2: 24,403,280 M719K probably benign Het
Ranbp9 A T 13: 43,425,117 M160K probably benign Het
Rfc1 A G 5: 65,277,363 Y687H probably damaging Het
Rimbp2 T C 5: 128,806,359 K119R probably damaging Het
Rnf113a1 T C X: 37,191,393 M1T probably null Het
Rnf40 A C 7: 127,596,334 K511Q possibly damaging Het
Ryr2 T A 13: 11,785,143 probably null Het
Scrib A T 15: 76,065,162 V365E probably damaging Het
Slc6a17 A G 3: 107,472,127 V575A possibly damaging Het
Spta1 A G 1: 174,240,166 N2053S possibly damaging Het
Ssbp2 G A 13: 91,642,392 probably null Het
Stab1 G T 14: 31,160,499 N460K probably benign Het
Tbc1d9 T A 8: 83,266,158 C964S probably benign Het
Tmed11 A G 5: 108,779,814 probably null Het
Tmem191c C A 16: 17,278,120 R285S probably damaging Het
Tpr T C 1: 150,436,801 S1917P probably benign Het
Vill A T 9: 119,063,372 H357L probably benign Het
Vmn1r229 A G 17: 20,814,789 T99A probably benign Het
Vmn2r14 A G 5: 109,221,417 S97P probably damaging Het
Wasf2 G T 4: 133,190,172 R194L unknown Het
Other mutations in Phf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Phf2 APN 13 48819607 missense unknown
IGL01554:Phf2 APN 13 48805879 nonsense probably null
IGL02063:Phf2 APN 13 48821642 missense unknown
IGL02456:Phf2 APN 13 48828846 missense unknown
IGL02498:Phf2 APN 13 48805239 missense unknown
IGL02586:Phf2 APN 13 48813858 splice site probably benign
IGL02688:Phf2 APN 13 48805839 missense unknown
H8441:Phf2 UTSW 13 48804365 missense possibly damaging 0.67
R0265:Phf2 UTSW 13 48828794 missense unknown
R0389:Phf2 UTSW 13 48804489 missense unknown
R0535:Phf2 UTSW 13 48813947 missense unknown
R1162:Phf2 UTSW 13 48819641 splice site probably benign
R1342:Phf2 UTSW 13 48804477 missense unknown
R1551:Phf2 UTSW 13 48803603 missense probably damaging 1.00
R1567:Phf2 UTSW 13 48832113 missense unknown
R1698:Phf2 UTSW 13 48807630 missense unknown
R1766:Phf2 UTSW 13 48819557 missense unknown
R1785:Phf2 UTSW 13 48817567 missense unknown
R1997:Phf2 UTSW 13 48828908 missense unknown
R2034:Phf2 UTSW 13 48817730 missense unknown
R2096:Phf2 UTSW 13 48832113 nonsense probably null
R2147:Phf2 UTSW 13 48804689 missense unknown
R2149:Phf2 UTSW 13 48804689 missense unknown
R2154:Phf2 UTSW 13 48820073 missense unknown
R2296:Phf2 UTSW 13 48835278 missense unknown
R4212:Phf2 UTSW 13 48820613 missense unknown
R4749:Phf2 UTSW 13 48821709 intron probably null
R4770:Phf2 UTSW 13 48803603 missense probably damaging 1.00
R4948:Phf2 UTSW 13 48807722 missense unknown
R4989:Phf2 UTSW 13 48807844 missense unknown
R5792:Phf2 UTSW 13 48820042 splice site probably null
R5848:Phf2 UTSW 13 48820070 missense unknown
R6092:Phf2 UTSW 13 48816057 missense unknown
R6165:Phf2 UTSW 13 48813865 critical splice donor site probably null
R6192:Phf2 UTSW 13 48820107 missense unknown
R6237:Phf2 UTSW 13 48803655 nonsense probably null
R6249:Phf2 UTSW 13 48805872 missense unknown
R6489:Phf2 UTSW 13 48826182 missense unknown
V1024:Phf2 UTSW 13 48804365 missense possibly damaging 0.67
X0027:Phf2 UTSW 13 48832118 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTGGGCTGAGTGAACACACAG -3'
(R):5'- TCACTATGGGGTCAGGGTGAGAAC -3'

Sequencing Primer
(F):5'- TGAGTGAACACACAGTCCCG -3'
(R):5'- GTCAACTCACCATTATGGGTCAG -3'
Posted On2014-04-13