Incidental Mutation 'R1553:Wapl'
ID170111
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene NameWAPL cohesin release factor
SynonymsA530089A20Rik, Wapal
MMRRC Submission 039592-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1553 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location34673928-34747983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34729190 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 727 (L727H)
Ref Sequence ENSEMBL: ENSMUSP00000130547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
Predicted Effect probably damaging
Transcript: ENSMUST00000048263
AA Change: L727H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: L727H

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090027
AA Change: L721H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: L721H

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111895
Predicted Effect unknown
Transcript: ENSMUST00000151285
AA Change: L11H
SMART Domains Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408
AA Change: L11H

DomainStartEndE-ValueType
Pfam:WAPL 1 281 1.1e-78 PFAM
coiled coil region 329 351 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169910
AA Change: L727H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: L727H

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172658
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 G T 5: 24,408,750 A649S probably damaging Het
Adam6a T A 12: 113,545,215 C403S probably damaging Het
Adgrg3 T C 8: 95,040,268 F417S possibly damaging Het
Ago1 T C 4: 126,440,401 E439G probably damaging Het
Alox15 A G 11: 70,349,632 V241A possibly damaging Het
Arhgap6 A G X: 169,265,484 H566R probably damaging Het
Asap1 A T 15: 64,152,852 F345I probably benign Het
Atp1b2 A G 11: 69,602,852 Y134H probably damaging Het
Atp8b3 G A 10: 80,532,542 T199M probably damaging Het
Calb1 A T 4: 15,895,656 S115C probably damaging Het
Ccdc68 A T 18: 69,940,121 I47F probably damaging Het
Cdc42bpa A T 1: 180,093,975 N560I probably benign Het
Cdhr3 T C 12: 33,042,371 D747G probably benign Het
Cdk5rap1 T G 2: 154,352,251 N378T probably damaging Het
Chil4 T G 3: 106,203,690 N296T probably benign Het
Cryaa G A 17: 31,679,559 V87I probably damaging Het
Csk G A 9: 57,630,942 L28F probably damaging Het
Cspp1 A G 1: 10,085,897 N444D possibly damaging Het
Cyp2j8 A G 4: 96,475,557 Y290H probably benign Het
Eps8l1 A T 7: 4,477,449 D563V probably damaging Het
Fam111a A T 19: 12,587,318 S144C possibly damaging Het
Fam135a A T 1: 24,021,870 S1145R probably damaging Het
Fpr2 T A 17: 17,893,594 V284D possibly damaging Het
Furin A G 7: 80,398,592 probably null Het
Gatd1 T C 7: 141,409,893 T135A probably benign Het
Gdf3 A G 6: 122,609,765 S68P probably benign Het
Gm6871 T C 7: 41,546,398 H305R probably benign Het
Grip1 A G 10: 120,054,851 S917G probably damaging Het
Hdac10 T A 15: 89,125,515 E388V possibly damaging Het
Hectd1 T C 12: 51,773,878 N1176S probably damaging Het
Hectd4 A G 5: 121,349,259 D3439G probably benign Het
Kcna4 T C 2: 107,296,687 Y589H probably benign Het
Kcnk5 A T 14: 20,142,394 L233Q probably damaging Het
Kcnt1 T C 2: 25,900,385 I453T probably damaging Het
Kifc3 A G 8: 95,106,542 I440T possibly damaging Het
Krt10 C A 11: 99,385,980 G40* probably null Het
Lce1i A T 3: 92,777,795 C25S unknown Het
Met A G 6: 17,491,461 N74S probably benign Het
Naa35 G A 13: 59,618,279 probably null Het
Naalad2 T C 9: 18,378,669 N221S probably benign Het
Nolc1 AGCG AGCGGCG 19: 46,081,375 probably benign Het
Nsmf T C 2: 25,060,259 V181A probably damaging Het
Nwd2 T A 5: 63,800,505 S393T probably benign Het
Olfr530 T A 7: 140,373,038 T191S probably damaging Het
Olfr575 T A 7: 102,955,218 I128L possibly damaging Het
Olfr709-ps1 A T 7: 106,926,994 V155E possibly damaging Het
Papola T A 12: 105,820,410 S453R probably benign Het
Paqr9 A G 9: 95,560,209 N84S probably damaging Het
Pde5a T C 3: 122,778,936 V290A probably benign Het
Prf1 T C 10: 61,303,169 V302A probably damaging Het
Psg18 T C 7: 18,353,481 Y84C probably benign Het
Rasgrf2 C T 13: 91,890,664 R1021H probably damaging Het
Rnf114 G T 2: 167,512,602 R201L possibly damaging Het
Rp1l1 A G 14: 64,031,894 E1643G probably benign Het
Scg3 T A 9: 75,669,304 E263V probably null Het
Scn2a C T 2: 65,713,836 R854* probably null Het
Setdb2 T C 14: 59,417,485 K319E probably benign Het
Stub1 A T 17: 25,832,123 V95E probably damaging Het
Tas2r140 T A 6: 133,055,508 N96Y probably damaging Het
Tecta T A 9: 42,348,186 D1467V probably damaging Het
Tenm3 T A 8: 48,236,421 T2044S probably damaging Het
Tlr2 T A 3: 83,837,463 M438L probably benign Het
Tmem179 T C 12: 112,504,660 Y106C probably benign Het
Tspan7 A G X: 10,585,615 H187R probably benign Het
Ttn T C 2: 76,927,275 D3332G probably damaging Het
Upp2 T C 2: 58,790,140 F326S probably damaging Het
Usp2 T A 9: 44,092,155 D224E probably damaging Het
Vmn1r5 T A 6: 56,985,498 F53I probably benign Het
Wipf1 T C 2: 73,437,526 D176G possibly damaging Het
Xpnpep1 G T 19: 53,006,338 D243E probably benign Het
Zfp616 A T 11: 74,083,918 I429F possibly damaging Het
Zfyve26 G A 12: 79,287,761 P161L probably benign Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34692636 missense probably benign 0.00
IGL00539:Wapl APN 14 34695008 missense probably damaging 1.00
IGL00846:Wapl APN 14 34692744 splice site probably benign
IGL01070:Wapl APN 14 34745622 unclassified probably benign
IGL01516:Wapl APN 14 34692081 missense probably damaging 1.00
IGL02021:Wapl APN 14 34722336 missense probably benign
IGL02209:Wapl APN 14 34677261 missense possibly damaging 0.46
IGL02309:Wapl APN 14 34744863 missense probably damaging 0.98
IGL02471:Wapl APN 14 34691920 missense possibly damaging 0.68
IGL02965:Wapl APN 14 34739224 intron probably benign
IGL03076:Wapl APN 14 34692089 missense probably benign 0.26
IGL03197:Wapl APN 14 34745631 missense possibly damaging 0.77
Mcclintock UTSW 14 34730662 critical splice donor site probably null
R0045:Wapl UTSW 14 34733794 missense probably benign 0.18
R0278:Wapl UTSW 14 34692612 missense possibly damaging 0.68
R0335:Wapl UTSW 14 34692324 missense probably damaging 0.99
R1018:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R1295:Wapl UTSW 14 34724769 missense probably damaging 1.00
R1868:Wapl UTSW 14 34692458 missense probably benign 0.00
R1909:Wapl UTSW 14 34691912 missense probably damaging 1.00
R2698:Wapl UTSW 14 34691777 missense probably benign
R2990:Wapl UTSW 14 34736708 missense probably damaging 0.98
R3121:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3122:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3147:Wapl UTSW 14 34725149 missense probably damaging 1.00
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3733:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3878:Wapl UTSW 14 34692147 missense probably damaging 1.00
R4034:Wapl UTSW 14 34737914 missense possibly damaging 0.92
R4934:Wapl UTSW 14 34692095 missense probably benign 0.11
R5079:Wapl UTSW 14 34724757 missense probably damaging 1.00
R5104:Wapl UTSW 14 34692059 nonsense probably null
R5113:Wapl UTSW 14 34724754 missense probably damaging 1.00
R5121:Wapl UTSW 14 34677162 missense probably benign 0.01
R5222:Wapl UTSW 14 34736685 nonsense probably null
R5299:Wapl UTSW 14 34733808 critical splice donor site probably null
R5387:Wapl UTSW 14 34677295 missense probably benign 0.00
R5541:Wapl UTSW 14 34730662 critical splice donor site probably null
R5618:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R5802:Wapl UTSW 14 34692320 missense probably damaging 1.00
R6029:Wapl UTSW 14 34739247 missense possibly damaging 0.94
R6292:Wapl UTSW 14 34729195 missense probably damaging 1.00
R6482:Wapl UTSW 14 34692692 missense probably benign 0.01
R6487:Wapl UTSW 14 34692292 missense probably damaging 1.00
R6925:Wapl UTSW 14 34677363 missense probably benign 0.31
R6937:Wapl UTSW 14 34722354 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGTTCAAAGAAATGGGTAGCGAAGGAT -3'
(R):5'- GCAGGGCTGAAGGCAGTGATT -3'

Sequencing Primer
(F):5'- TAGAGAGGAAAGCACAACTTTAAATC -3'
(R):5'- ACAGTTTCACAGAGTCTTCGG -3'
Posted On2014-04-13