Incidental Mutation 'R1555:Spg11'
ID170208
Institutional Source Beutler Lab
Gene Symbol Spg11
Ensembl Gene ENSMUSG00000033396
Gene NameSPG11, spatacsin vesicle trafficking associated
SynonymsC530005A01Rik, 6030465E24Rik
MMRRC Submission 039594-MU
Accession Numbers

Genbank: NM_145531

Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R1555 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location122053520-122118386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122097377 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 642 (E642G)
Ref Sequence ENSEMBL: ENSMUSP00000037543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036450]
Predicted Effect probably damaging
Transcript: ENSMUST00000036450
AA Change: E642G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037543
Gene: ENSMUSG00000033396
AA Change: E642G

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 254 276 N/A INTRINSIC
low complexity region 945 958 N/A INTRINSIC
low complexity region 1250 1264 N/A INTRINSIC
low complexity region 1305 1313 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
low complexity region 1772 1784 N/A INTRINSIC
Pfam:Spatacsin_C 2082 2374 1.1e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133145
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele develop a progressive spastic and ataxic gait disorder and show loss of cortical motoneurons and Purkinje cells, a reduced number of lysosomes available for fusion with autophagosomes in degenerating neurons, and accumulation of autolysosome-derived material. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,974,901 probably null Het
Adamts1 T A 16: 85,797,888 T358S probably benign Het
Ate1 A T 7: 130,509,091 F169I probably benign Het
Cdkl4 T A 17: 80,543,614 probably benign Het
Clcnkb T C 4: 141,411,739 probably null Het
Col6a4 C T 9: 106,000,886 R1964Q possibly damaging Het
Dcakd C T 11: 103,000,213 V17I probably damaging Het
Dcdc5 T G 2: 106,384,135 noncoding transcript Het
Erc2 T A 14: 28,011,665 D557E probably damaging Het
Grid2 A T 6: 64,429,684 D676V possibly damaging Het
Hebp2 G T 10: 18,544,415 T90K possibly damaging Het
Igkv10-96 C T 6: 68,632,381 probably benign Het
Mier3 T A 13: 111,708,359 N248K probably damaging Het
Myo5b A T 18: 74,569,782 I15F probably damaging Het
Neurl3 A G 1: 36,266,532 V198A probably benign Het
Notch2 C A 3: 98,131,340 N1266K possibly damaging Het
Nup107 A G 10: 117,751,490 probably benign Het
Olfr214 A T 6: 116,556,826 I134F probably damaging Het
Olfr675 T C 7: 105,024,522 I153V probably benign Het
Phf3 G T 1: 30,805,877 H1334N possibly damaging Het
Phyhd1 T A 2: 30,274,706 I100N probably damaging Het
Rad21l T A 2: 151,658,428 T224S probably benign Het
Rxra C T 2: 27,748,678 A231V probably benign Het
Sac3d1 T C 19: 6,118,405 D61G probably damaging Het
Sbf1 A G 15: 89,305,076 Y481H probably damaging Het
Spta1 A G 1: 174,178,749 Y159C probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tedc1 G T 12: 113,156,497 probably benign Het
Tmem200a A T 10: 25,993,884 D162E probably damaging Het
Tmprss11e T A 5: 86,715,588 Q206L probably damaging Het
Tpra1 A G 6: 88,910,203 N175S probably damaging Het
Ttll10 T C 4: 156,035,139 E601G probably benign Het
Ttll6 G T 11: 96,145,582 D346Y probably damaging Het
U2surp A G 9: 95,466,577 V874A probably damaging Het
Vwa5b1 T C 4: 138,605,477 K258R probably benign Het
Xkr6 A G 14: 63,818,925 Y95C unknown Het
Zfp180 T C 7: 24,101,574 probably benign Het
Zfp90 A G 8: 106,424,095 T147A probably benign Het
Other mutations in Spg11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Spg11 APN 2 122065560 missense probably damaging 0.96
IGL00495:Spg11 APN 2 122094456 critical splice donor site probably null
IGL00757:Spg11 APN 2 122070959 missense probably benign 0.05
IGL01304:Spg11 APN 2 122072290 missense probably damaging 1.00
IGL01355:Spg11 APN 2 122113156 missense probably benign
IGL01626:Spg11 APN 2 122060971 missense probably damaging 0.98
IGL01739:Spg11 APN 2 122114671 missense probably damaging 1.00
IGL01835:Spg11 APN 2 122088224 missense probably benign 0.36
IGL02129:Spg11 APN 2 122095686 missense probably damaging 0.99
IGL02178:Spg11 APN 2 122097302 missense probably damaging 1.00
IGL02199:Spg11 APN 2 122059553 missense probably damaging 1.00
IGL02212:Spg11 APN 2 122108157 missense probably benign 0.31
IGL02605:Spg11 APN 2 122092260 missense probably benign 0.00
IGL02635:Spg11 APN 2 122113068 missense possibly damaging 0.52
IGL02743:Spg11 APN 2 122059507 missense probably damaging 0.97
IGL02822:Spg11 APN 2 122074534 missense probably damaging 0.99
IGL02992:Spg11 APN 2 122058398 missense probably damaging 1.00
IGL03010:Spg11 APN 2 122088320 missense probably damaging 0.96
3-1:Spg11 UTSW 2 122086890 missense probably damaging 0.98
PIT4354001:Spg11 UTSW 2 122088185 missense probably damaging 0.98
R0131:Spg11 UTSW 2 122070968 missense probably damaging 1.00
R0206:Spg11 UTSW 2 122055696 critical splice donor site probably null
R0208:Spg11 UTSW 2 122055696 critical splice donor site probably null
R0302:Spg11 UTSW 2 122092187 missense possibly damaging 0.90
R0347:Spg11 UTSW 2 122097369 missense probably damaging 0.99
R0357:Spg11 UTSW 2 122066232 splice site probably benign
R0372:Spg11 UTSW 2 122059447 frame shift probably null
R0715:Spg11 UTSW 2 122084983 missense probably benign 0.03
R0927:Spg11 UTSW 2 122094487 missense probably damaging 0.99
R1163:Spg11 UTSW 2 122070941 missense probably damaging 1.00
R1534:Spg11 UTSW 2 122092325 missense probably damaging 1.00
R1569:Spg11 UTSW 2 122101706 missense probably damaging 0.99
R1840:Spg11 UTSW 2 122101756 missense probably damaging 1.00
R1929:Spg11 UTSW 2 122060207 missense probably damaging 1.00
R2265:Spg11 UTSW 2 122108307 missense possibly damaging 0.48
R2303:Spg11 UTSW 2 122068837 missense probably damaging 0.99
R2510:Spg11 UTSW 2 122075310 missense probably benign 0.03
R2760:Spg11 UTSW 2 122097359 missense probably damaging 0.99
R2918:Spg11 UTSW 2 122075301 missense probably damaging 0.99
R3195:Spg11 UTSW 2 122083398 critical splice donor site probably null
R3423:Spg11 UTSW 2 122071053 missense probably benign 0.00
R4353:Spg11 UTSW 2 122113194 missense possibly damaging 0.92
R4407:Spg11 UTSW 2 122075332 missense probably benign 0.00
R4644:Spg11 UTSW 2 122061029 missense probably benign 0.03
R4663:Spg11 UTSW 2 122098099 critical splice donor site probably null
R4684:Spg11 UTSW 2 122065076 missense probably damaging 1.00
R4771:Spg11 UTSW 2 122065482 nonsense probably null
R4810:Spg11 UTSW 2 122059796 missense probably damaging 1.00
R4829:Spg11 UTSW 2 122108455 missense probably benign 0.44
R5089:Spg11 UTSW 2 122114717 nonsense probably null
R5362:Spg11 UTSW 2 122061000 missense probably damaging 0.99
R5684:Spg11 UTSW 2 122093503 missense probably damaging 1.00
R5899:Spg11 UTSW 2 122098199 missense possibly damaging 0.67
R5923:Spg11 UTSW 2 122093478 missense probably damaging 0.98
R6052:Spg11 UTSW 2 122097356 missense probably damaging 0.99
R6111:Spg11 UTSW 2 122093482 missense probably damaging 0.98
R6174:Spg11 UTSW 2 122086805 intron probably null
R6226:Spg11 UTSW 2 122088262 missense possibly damaging 0.69
R6336:Spg11 UTSW 2 122112959 unclassified probably null
R6480:Spg11 UTSW 2 122092305 missense probably benign 0.03
R6494:Spg11 UTSW 2 122113225 missense probably damaging 0.98
R6582:Spg11 UTSW 2 122092292 missense probably damaging 0.99
R6714:Spg11 UTSW 2 122095731 missense probably damaging 0.99
R6791:Spg11 UTSW 2 122093443 missense probably damaging 0.99
R6836:Spg11 UTSW 2 122059535 missense probably damaging 1.00
R6928:Spg11 UTSW 2 122069904 missense probably benign 0.37
R7229:Spg11 UTSW 2 122108104 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCTGACGCATACGTGCTCACTC -3'
(R):5'- GACACACTGCTGCAAAGAAAGCTG -3'

Sequencing Primer
(F):5'- TCACCTCAAAGCTGAGTTCC -3'
(R):5'- TTCCATTCCTGTTTacacatgc -3'
Posted On2014-04-13