Incidental Mutation 'R1555:Zfp180'
ID170222
Institutional Source Beutler Lab
Gene Symbol Zfp180
Ensembl Gene ENSMUSG00000057101
Gene Namezinc finger protein 180
SynonymsHHZ168, 2310040I01Rik, D130011P11
MMRRC Submission 039594-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R1555 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24081924-24107713 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 24101574 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068975] [ENSMUST00000203854] [ENSMUST00000206184] [ENSMUST00000207002]
Predicted Effect probably benign
Transcript: ENSMUST00000068975
SMART Domains Protein: ENSMUSP00000064611
Gene: ENSMUSG00000057101

DomainStartEndE-ValueType
Blast:KRAB 46 103 7e-14 BLAST
ZnF_C2H2 318 340 3.21e-4 SMART
ZnF_C2H2 346 368 3.39e-3 SMART
ZnF_C2H2 374 396 1.72e-4 SMART
ZnF_C2H2 402 424 4.87e-4 SMART
ZnF_C2H2 430 452 1.58e-3 SMART
ZnF_C2H2 458 480 5.99e-4 SMART
ZnF_C2H2 486 508 2.12e-4 SMART
ZnF_C2H2 514 536 1.6e-4 SMART
ZnF_C2H2 542 564 3.95e-4 SMART
ZnF_C2H2 570 592 5.9e-3 SMART
ZnF_C2H2 598 620 1.12e-3 SMART
ZnF_C2H2 626 648 4.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203854
SMART Domains Protein: ENSMUSP00000145165
Gene: ENSMUSG00000057101

DomainStartEndE-ValueType
Blast:KRAB 12 69 4e-14 BLAST
ZnF_C2H2 284 306 3.21e-4 SMART
ZnF_C2H2 312 334 3.39e-3 SMART
ZnF_C2H2 340 362 1.72e-4 SMART
ZnF_C2H2 368 390 4.87e-4 SMART
ZnF_C2H2 396 418 1.58e-3 SMART
ZnF_C2H2 424 446 5.99e-4 SMART
ZnF_C2H2 452 474 2.12e-4 SMART
ZnF_C2H2 480 502 1.6e-4 SMART
ZnF_C2H2 508 530 3.95e-4 SMART
ZnF_C2H2 536 558 5.9e-3 SMART
ZnF_C2H2 564 586 1.12e-3 SMART
ZnF_C2H2 592 614 4.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206482
Predicted Effect probably benign
Transcript: ENSMUST00000207002
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc finger proteins have been shown to interact with nucleic acids and to have diverse functions. The zinc finger domain is a conserved amino acid sequence motif containing 2 specifically positioned cysteines and 2 histidines that are involved in coordinating zinc. Kruppel-related proteins form 1 family of zinc finger proteins. See MIM 604749 for additional information on zinc finger proteins.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,974,901 probably null Het
Adamts1 T A 16: 85,797,888 T358S probably benign Het
Ate1 A T 7: 130,509,091 F169I probably benign Het
Cdkl4 T A 17: 80,543,614 probably benign Het
Clcnkb T C 4: 141,411,739 probably null Het
Col6a4 C T 9: 106,000,886 R1964Q possibly damaging Het
Dcakd C T 11: 103,000,213 V17I probably damaging Het
Dcdc5 T G 2: 106,384,135 noncoding transcript Het
Erc2 T A 14: 28,011,665 D557E probably damaging Het
Grid2 A T 6: 64,429,684 D676V possibly damaging Het
Hebp2 G T 10: 18,544,415 T90K possibly damaging Het
Igkv10-96 C T 6: 68,632,381 probably benign Het
Mier3 T A 13: 111,708,359 N248K probably damaging Het
Myo5b A T 18: 74,569,782 I15F probably damaging Het
Neurl3 A G 1: 36,266,532 V198A probably benign Het
Notch2 C A 3: 98,131,340 N1266K possibly damaging Het
Nup107 A G 10: 117,751,490 probably benign Het
Olfr214 A T 6: 116,556,826 I134F probably damaging Het
Olfr675 T C 7: 105,024,522 I153V probably benign Het
Phf3 G T 1: 30,805,877 H1334N possibly damaging Het
Phyhd1 T A 2: 30,274,706 I100N probably damaging Het
Rad21l T A 2: 151,658,428 T224S probably benign Het
Rxra C T 2: 27,748,678 A231V probably benign Het
Sac3d1 T C 19: 6,118,405 D61G probably damaging Het
Sbf1 A G 15: 89,305,076 Y481H probably damaging Het
Spg11 T C 2: 122,097,377 E642G probably damaging Het
Spta1 A G 1: 174,178,749 Y159C probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tedc1 G T 12: 113,156,497 probably benign Het
Tmem200a A T 10: 25,993,884 D162E probably damaging Het
Tmprss11e T A 5: 86,715,588 Q206L probably damaging Het
Tpra1 A G 6: 88,910,203 N175S probably damaging Het
Ttll10 T C 4: 156,035,139 E601G probably benign Het
Ttll6 G T 11: 96,145,582 D346Y probably damaging Het
U2surp A G 9: 95,466,577 V874A probably damaging Het
Vwa5b1 T C 4: 138,605,477 K258R probably benign Het
Xkr6 A G 14: 63,818,925 Y95C unknown Het
Zfp90 A G 8: 106,424,095 T147A probably benign Het
Other mutations in Zfp180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Zfp180 APN 7 24085469 missense probably damaging 0.98
IGL00990:Zfp180 APN 7 24104830 missense probably benign 0.42
IGL00990:Zfp180 APN 7 24104995 missense possibly damaging 0.60
IGL00990:Zfp180 APN 7 24104416 missense possibly damaging 0.83
IGL01061:Zfp180 APN 7 24104745 missense possibly damaging 0.50
IGL01328:Zfp180 APN 7 24101479 missense probably benign 0.01
IGL03134:Zfp180 UTSW 7 24104745 missense possibly damaging 0.50
R0137:Zfp180 UTSW 7 24105733 missense possibly damaging 0.93
R0390:Zfp180 UTSW 7 24104707 missense possibly damaging 0.95
R1451:Zfp180 UTSW 7 24105218 missense probably benign 0.00
R1534:Zfp180 UTSW 7 24101523 missense probably benign 0.31
R1577:Zfp180 UTSW 7 24105908 missense probably damaging 1.00
R1605:Zfp180 UTSW 7 24104624 missense probably benign 0.00
R1633:Zfp180 UTSW 7 24104801 missense probably benign 0.07
R1817:Zfp180 UTSW 7 24105227 missense probably damaging 1.00
R2012:Zfp180 UTSW 7 24104518 missense probably benign 0.01
R2076:Zfp180 UTSW 7 24105103 missense probably damaging 1.00
R2151:Zfp180 UTSW 7 24105260 missense probably damaging 1.00
R2262:Zfp180 UTSW 7 24104624 missense probably benign 0.32
R3081:Zfp180 UTSW 7 24105503 missense probably damaging 1.00
R3402:Zfp180 UTSW 7 24105745 missense probably benign 0.30
R4551:Zfp180 UTSW 7 24104573 missense possibly damaging 0.87
R4747:Zfp180 UTSW 7 24105821 missense probably damaging 1.00
R4983:Zfp180 UTSW 7 24106078 missense probably damaging 0.98
R5610:Zfp180 UTSW 7 24104890 missense probably benign 0.00
R5764:Zfp180 UTSW 7 24101484 missense possibly damaging 0.71
R5987:Zfp180 UTSW 7 24105434 missense probably damaging 1.00
R6207:Zfp180 UTSW 7 24105085 nonsense probably null
R6247:Zfp180 UTSW 7 24105105 missense probably damaging 1.00
R6328:Zfp180 UTSW 7 24105556 missense probably damaging 1.00
R6708:Zfp180 UTSW 7 24106096 missense probably damaging 0.98
R6814:Zfp180 UTSW 7 24105881 missense probably damaging 1.00
R6872:Zfp180 UTSW 7 24105881 missense probably damaging 1.00
R7006:Zfp180 UTSW 7 24105112 nonsense probably null
R7084:Zfp180 UTSW 7 24105261 missense probably damaging 1.00
R7101:Zfp180 UTSW 7 24104533 missense probably benign 0.00
R7213:Zfp180 UTSW 7 24104513 missense possibly damaging 0.87
R7263:Zfp180 UTSW 7 24105700 nonsense probably null
R7360:Zfp180 UTSW 7 24105490 missense probably damaging 1.00
R7487:Zfp180 UTSW 7 24106100 missense probably damaging 1.00
V5622:Zfp180 UTSW 7 24082031 start gained probably benign
X0067:Zfp180 UTSW 7 24105472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCAGCTAAGCAGGAATGTG -3'
(R):5'- AGGAATGCCTGGTCTCTCAGTGTG -3'

Sequencing Primer
(F):5'- CTAAGCAGGAATGTGTGTGCTG -3'
(R):5'- AGCCAGGCTGCTAAGTTTC -3'
Posted On2014-04-13