Incidental Mutation 'R1555:Cdkl4'
ID170241
Institutional Source Beutler Lab
Gene Symbol Cdkl4
Ensembl Gene ENSMUSG00000033966
Gene Namecyclin-dependent kinase-like 4
SynonymsLOC381113
MMRRC Submission 039594-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1555 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location80523550-80563834 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 80543614 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086545]
Predicted Effect probably benign
Transcript: ENSMUST00000086545
SMART Domains Protein: ENSMUSP00000083732
Gene: ENSMUSG00000033966

DomainStartEndE-ValueType
S_TKc 4 286 6.65e-102 SMART
low complexity region 295 307 N/A INTRINSIC
Meta Mutation Damage Score 0.1332 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,974,901 probably null Het
Adamts1 T A 16: 85,797,888 T358S probably benign Het
Ate1 A T 7: 130,509,091 F169I probably benign Het
Clcnkb T C 4: 141,411,739 probably null Het
Col6a4 C T 9: 106,000,886 R1964Q possibly damaging Het
Dcakd C T 11: 103,000,213 V17I probably damaging Het
Dcdc5 T G 2: 106,384,135 noncoding transcript Het
Erc2 T A 14: 28,011,665 D557E probably damaging Het
Grid2 A T 6: 64,429,684 D676V possibly damaging Het
Hebp2 G T 10: 18,544,415 T90K possibly damaging Het
Igkv10-96 C T 6: 68,632,381 probably benign Het
Mier3 T A 13: 111,708,359 N248K probably damaging Het
Myo5b A T 18: 74,569,782 I15F probably damaging Het
Neurl3 A G 1: 36,266,532 V198A probably benign Het
Notch2 C A 3: 98,131,340 N1266K possibly damaging Het
Nup107 A G 10: 117,751,490 probably benign Het
Olfr214 A T 6: 116,556,826 I134F probably damaging Het
Olfr675 T C 7: 105,024,522 I153V probably benign Het
Phf3 G T 1: 30,805,877 H1334N possibly damaging Het
Phyhd1 T A 2: 30,274,706 I100N probably damaging Het
Rad21l T A 2: 151,658,428 T224S probably benign Het
Rxra C T 2: 27,748,678 A231V probably benign Het
Sac3d1 T C 19: 6,118,405 D61G probably damaging Het
Sbf1 A G 15: 89,305,076 Y481H probably damaging Het
Spg11 T C 2: 122,097,377 E642G probably damaging Het
Spta1 A G 1: 174,178,749 Y159C probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tedc1 G T 12: 113,156,497 probably benign Het
Tmem200a A T 10: 25,993,884 D162E probably damaging Het
Tmprss11e T A 5: 86,715,588 Q206L probably damaging Het
Tpra1 A G 6: 88,910,203 N175S probably damaging Het
Ttll10 T C 4: 156,035,139 E601G probably benign Het
Ttll6 G T 11: 96,145,582 D346Y probably damaging Het
U2surp A G 9: 95,466,577 V874A probably damaging Het
Vwa5b1 T C 4: 138,605,477 K258R probably benign Het
Xkr6 A G 14: 63,818,925 Y95C unknown Het
Zfp180 T C 7: 24,101,574 probably benign Het
Zfp90 A G 8: 106,424,095 T147A probably benign Het
Other mutations in Cdkl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Cdkl4 APN 17 80525276 utr 3 prime probably benign
IGL01752:Cdkl4 APN 17 80543614 splice site probably benign
IGL02000:Cdkl4 APN 17 80543763 missense probably damaging 1.00
IGL02393:Cdkl4 APN 17 80560415 missense probably damaging 1.00
R0047:Cdkl4 UTSW 17 80550845 missense probably benign 0.10
R0507:Cdkl4 UTSW 17 80543808 missense probably benign 0.06
R1623:Cdkl4 UTSW 17 80556302 splice site probably null
R2007:Cdkl4 UTSW 17 80556301 splice site probably benign
R4701:Cdkl4 UTSW 17 80543652 missense probably damaging 0.97
R4975:Cdkl4 UTSW 17 80525335 nonsense probably null
R5246:Cdkl4 UTSW 17 80539484 intron probably null
R5708:Cdkl4 UTSW 17 80539522 missense possibly damaging 0.94
R5914:Cdkl4 UTSW 17 80547691 critical splice donor site probably null
R6464:Cdkl4 UTSW 17 80525352 missense probably benign 0.00
R6882:Cdkl4 UTSW 17 80543746 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGGCTGCCATTTAGGTCAGACTG -3'
(R):5'- GCCTACACAGACTATGTTGCCACC -3'

Sequencing Primer
(F):5'- AGGTCAGACTGACTGGATTTTC -3'
(R):5'- TTTTTGCAGAGCTCCTGACG -3'
Posted On2014-04-13