Incidental Mutation 'R1556:Sh3bgrl2'
ID170273
Institutional Source Beutler Lab
Gene Symbol Sh3bgrl2
Ensembl Gene ENSMUSG00000032261
Gene NameSH3 domain binding glutamic acid-rich protein like 2
SynonymsA930014C21Rik
MMRRC Submission 039595-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R1556 (G1)
Quality Score218
Status Not validated
Chromosome9
Chromosomal Location83548327-83638801 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83594698 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 91 (V91A)
Ref Sequence ENSEMBL: ENSMUSP00000140951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113215] [ENSMUST00000188030] [ENSMUST00000188241]
Predicted Effect probably damaging
Transcript: ENSMUST00000113215
AA Change: V91A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108841
Gene: ENSMUSG00000032261
AA Change: V91A

DomainStartEndE-ValueType
Pfam:SH3BGR 1 98 1.3e-50 PFAM
Pfam:Glutaredoxin 21 76 1.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185664
SMART Domains Protein: ENSMUSP00000140380
Gene: ENSMUSG00000032261

DomainStartEndE-ValueType
Pfam:SH3BGR 1 58 1.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188030
SMART Domains Protein: ENSMUSP00000140348
Gene: ENSMUSG00000032261

DomainStartEndE-ValueType
Pfam:SH3BGR 1 85 8.2e-36 PFAM
Pfam:Glutaredoxin 21 76 5.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188241
AA Change: V91A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140951
Gene: ENSMUSG00000032261
AA Change: V91A

DomainStartEndE-ValueType
Pfam:SH3BGR 1 98 2.1e-47 PFAM
Pfam:Glutaredoxin 21 76 1.1e-6 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,449,633 S302P probably damaging Het
Anapc1 T C 2: 128,624,899 T1626A probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Arid5a T A 1: 36,320,164 Y520* probably null Het
Aven G A 2: 112,630,885 M215I probably damaging Het
Cabyr A G 18: 12,744,780 D58G probably damaging Het
Ccdc146 A G 5: 21,330,553 Y168H probably damaging Het
Ccnd2 A T 6: 127,130,400 S269T probably benign Het
Cd68 T A 11: 69,665,850 T44S probably damaging Het
Clstn2 A T 9: 97,456,505 I867N probably benign Het
Cmss1 C T 16: 57,316,197 R104H probably benign Het
Col6a6 A G 9: 105,709,473 V1783A possibly damaging Het
Dach2 T C X: 113,298,517 S31P probably benign Het
Dpp8 T A 9: 65,051,479 W279R probably damaging Het
Fras1 A T 5: 96,743,062 I2817F possibly damaging Het
Gabrr3 G A 16: 59,461,400 D373N probably benign Het
Gdf7 T C 12: 8,301,698 N79S unknown Het
Gpam A G 19: 55,076,331 V647A possibly damaging Het
Gpatch1 T C 7: 35,295,351 T497A probably benign Het
Grin2a A T 16: 9,707,715 F337L probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
H2-Aa A T 17: 34,284,416 V69D possibly damaging Het
H2-M10.5 T C 17: 36,773,313 Y56H probably damaging Het
Kcnu1 G A 8: 25,861,191 probably null Het
Krt77 A G 15: 101,861,278 S386P probably damaging Het
L3mbtl2 T A 15: 81,682,002 M342K probably benign Het
Ldlrad1 A G 4: 107,217,813 T186A probably benign Het
Lins1 C A 7: 66,710,637 C168* probably null Het
Lrrtm3 G A 10: 64,088,149 T413M probably damaging Het
Macf1 T C 4: 123,455,020 D4038G probably damaging Het
Mark3 T G 12: 111,627,841 N308K probably damaging Het
Mdga2 T A 12: 66,550,593 Y709F possibly damaging Het
Mtus2 T A 5: 148,077,388 S330R probably benign Het
Olfr59 T A 11: 74,288,936 C97S probably damaging Het
Olfr645 T A 7: 104,084,261 H273L probably benign Het
Olfr726 G A 14: 50,084,459 A74V possibly damaging Het
Olfr809 T C 10: 129,776,373 V168A probably benign Het
Ovgp1 A G 3: 105,986,752 probably benign Het
P4ha2 A G 11: 54,125,010 T408A probably damaging Het
Pcdh8 T G 14: 79,770,403 D240A probably damaging Het
Pcyt2 T C 11: 120,612,085 probably null Het
Pecr T A 1: 72,259,383 I293L probably benign Het
Pogk A G 1: 166,398,833 V583A possibly damaging Het
Prkg1 T C 19: 30,624,743 K371R probably benign Het
Psmd2 T A 16: 20,655,585 M297K possibly damaging Het
Rgs12 A G 5: 35,039,282 R769G possibly damaging Het
Sgtb T A 13: 104,139,776 N237K probably damaging Het
Slc4a1ap G A 5: 31,534,210 probably null Het
Slc4a7 T C 14: 14,778,872 V940A probably benign Het
Tep1 T C 14: 50,853,042 T740A probably benign Het
Tnk2 G T 16: 32,670,919 probably null Het
Trpv2 A G 11: 62,592,233 Y450C probably damaging Het
Tvp23a A T 16: 10,446,998 D16E probably damaging Het
Twnk T C 19: 45,009,411 F460L possibly damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Urb2 T C 8: 124,030,617 L1021P probably damaging Het
Vps13c T C 9: 67,930,711 Y1848H probably damaging Het
Vwa8 T G 14: 79,086,681 N1141K probably benign Het
Yipf3 A G 17: 46,250,867 Y200C probably damaging Het
Zbtb38 A G 9: 96,686,991 V680A probably benign Het
Zcchc6 T C 13: 59,800,240 T354A probably benign Het
Znrf3 T C 11: 5,281,347 E722G probably benign Het
Zzef1 T A 11: 72,915,233 L2665H probably damaging Het
Other mutations in Sh3bgrl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Sh3bgrl2 APN 9 83577554 missense probably benign 0.01
IGL00950:Sh3bgrl2 APN 9 83577490 missense probably damaging 1.00
R0119:Sh3bgrl2 UTSW 9 83577559 missense probably damaging 0.99
R0299:Sh3bgrl2 UTSW 9 83577559 missense probably damaging 0.99
R0499:Sh3bgrl2 UTSW 9 83577559 missense probably damaging 0.99
R1004:Sh3bgrl2 UTSW 9 83577631 splice site probably benign
R1006:Sh3bgrl2 UTSW 9 83577631 splice site probably benign
R1331:Sh3bgrl2 UTSW 9 83577631 splice site probably benign
R1333:Sh3bgrl2 UTSW 9 83577631 splice site probably benign
R5029:Sh3bgrl2 UTSW 9 83548489 missense possibly damaging 0.94
R5328:Sh3bgrl2 UTSW 9 83577456 missense probably benign 0.36
R7327:Sh3bgrl2 UTSW 9 83548489 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACACACTGAATCCAGTGGGTGC -3'
(R):5'- TGTGATTCCCCATCTGTGACCAAAC -3'

Sequencing Primer
(F):5'- CCTTGACCGAGCAATGGTACAT -3'
(R):5'- TTAGCAGGGTAGATACATGCCTC -3'
Posted On2014-04-13