Incidental Mutation 'R1556:P4ha2'
Institutional Source Beutler Lab
Gene Symbol P4ha2
Ensembl Gene ENSMUSG00000018906
Gene Nameprocollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha II polypeptide
MMRRC Submission 039595-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.421) question?
Stock #R1556 (G1)
Quality Score225
Status Not validated
Chromosomal Location54100095-54131665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54125010 bp
Amino Acid Change Threonine to Alanine at position 408 (T408A)
Ref Sequence ENSEMBL: ENSMUSP00000133275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019050] [ENSMUST00000093107] [ENSMUST00000141258] [ENSMUST00000174616]
Predicted Effect probably damaging
Transcript: ENSMUST00000019050
AA Change: T408A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019050
Gene: ENSMUSG00000018906
AA Change: T408A

signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 28 159 2.6e-40 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
Blast:P4Hc 232 303 4e-13 BLAST
P4Hc 338 521 1.61e-67 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093107
AA Change: T408A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091749
Gene: ENSMUSG00000018906
AA Change: T408A

signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 160 6.3e-44 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
P4Hc 338 519 7.67e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139315
Predicted Effect probably benign
Transcript: ENSMUST00000141258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142583
Predicted Effect probably damaging
Transcript: ENSMUST00000174616
AA Change: T408A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133275
Gene: ENSMUSG00000018906
AA Change: T408A

signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 160 6.3e-44 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
P4Hc 338 519 7.67e-65 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,449,633 S302P probably damaging Het
Anapc1 T C 2: 128,624,899 T1626A probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Arid5a T A 1: 36,320,164 Y520* probably null Het
Aven G A 2: 112,630,885 M215I probably damaging Het
Cabyr A G 18: 12,744,780 D58G probably damaging Het
Ccdc146 A G 5: 21,330,553 Y168H probably damaging Het
Ccnd2 A T 6: 127,130,400 S269T probably benign Het
Cd68 T A 11: 69,665,850 T44S probably damaging Het
Clstn2 A T 9: 97,456,505 I867N probably benign Het
Cmss1 C T 16: 57,316,197 R104H probably benign Het
Col6a6 A G 9: 105,709,473 V1783A possibly damaging Het
Dach2 T C X: 113,298,517 S31P probably benign Het
Dpp8 T A 9: 65,051,479 W279R probably damaging Het
Fras1 A T 5: 96,743,062 I2817F possibly damaging Het
Gabrr3 G A 16: 59,461,400 D373N probably benign Het
Gdf7 T C 12: 8,301,698 N79S unknown Het
Gpam A G 19: 55,076,331 V647A possibly damaging Het
Gpatch1 T C 7: 35,295,351 T497A probably benign Het
Grin2a A T 16: 9,707,715 F337L probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
H2-Aa A T 17: 34,284,416 V69D possibly damaging Het
H2-M10.5 T C 17: 36,773,313 Y56H probably damaging Het
Kcnu1 G A 8: 25,861,191 probably null Het
Krt77 A G 15: 101,861,278 S386P probably damaging Het
L3mbtl2 T A 15: 81,682,002 M342K probably benign Het
Ldlrad1 A G 4: 107,217,813 T186A probably benign Het
Lins1 C A 7: 66,710,637 C168* probably null Het
Lrrtm3 G A 10: 64,088,149 T413M probably damaging Het
Macf1 T C 4: 123,455,020 D4038G probably damaging Het
Mark3 T G 12: 111,627,841 N308K probably damaging Het
Mdga2 T A 12: 66,550,593 Y709F possibly damaging Het
Mtus2 T A 5: 148,077,388 S330R probably benign Het
Olfr59 T A 11: 74,288,936 C97S probably damaging Het
Olfr645 T A 7: 104,084,261 H273L probably benign Het
Olfr726 G A 14: 50,084,459 A74V possibly damaging Het
Olfr809 T C 10: 129,776,373 V168A probably benign Het
Ovgp1 A G 3: 105,986,752 probably benign Het
Pcdh8 T G 14: 79,770,403 D240A probably damaging Het
Pcyt2 T C 11: 120,612,085 probably null Het
Pecr T A 1: 72,259,383 I293L probably benign Het
Pogk A G 1: 166,398,833 V583A possibly damaging Het
Prkg1 T C 19: 30,624,743 K371R probably benign Het
Psmd2 T A 16: 20,655,585 M297K possibly damaging Het
Rgs12 A G 5: 35,039,282 R769G possibly damaging Het
Sgtb T A 13: 104,139,776 N237K probably damaging Het
Sh3bgrl2 T C 9: 83,594,698 V91A probably damaging Het
Slc4a1ap G A 5: 31,534,210 probably null Het
Slc4a7 T C 14: 14,778,872 V940A probably benign Het
Tep1 T C 14: 50,853,042 T740A probably benign Het
Tnk2 G T 16: 32,670,919 probably null Het
Trpv2 A G 11: 62,592,233 Y450C probably damaging Het
Tvp23a A T 16: 10,446,998 D16E probably damaging Het
Twnk T C 19: 45,009,411 F460L possibly damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Urb2 T C 8: 124,030,617 L1021P probably damaging Het
Vps13c T C 9: 67,930,711 Y1848H probably damaging Het
Vwa8 T G 14: 79,086,681 N1141K probably benign Het
Yipf3 A G 17: 46,250,867 Y200C probably damaging Het
Zbtb38 A G 9: 96,686,991 V680A probably benign Het
Zcchc6 T C 13: 59,800,240 T354A probably benign Het
Znrf3 T C 11: 5,281,347 E722G probably benign Het
Zzef1 T A 11: 72,915,233 L2665H probably damaging Het
Other mutations in P4ha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:P4ha2 APN 11 54119305 missense probably damaging 1.00
IGL01324:P4ha2 APN 11 54120158 missense probably damaging 0.99
IGL01953:P4ha2 APN 11 54114170 missense probably benign 0.07
IGL02053:P4ha2 APN 11 54117587 missense probably benign
FR4342:P4ha2 UTSW 11 54110251 small deletion probably benign
R0471:P4ha2 UTSW 11 54117608 missense possibly damaging 0.82
R0938:P4ha2 UTSW 11 54119322 missense possibly damaging 0.67
R1467:P4ha2 UTSW 11 54106410 intron probably benign
R1517:P4ha2 UTSW 11 54117645 missense probably benign
R3498:P4ha2 UTSW 11 54119253 missense probably benign 0.28
R3916:P4ha2 UTSW 11 54126248 missense probably benign 0.07
R4853:P4ha2 UTSW 11 54120170 missense probably benign 0.01
R4932:P4ha2 UTSW 11 54125020 missense probably benign 0.05
R5020:P4ha2 UTSW 11 54131190 missense probably damaging 1.00
R5892:P4ha2 UTSW 11 54120188 missense probably damaging 1.00
R5975:P4ha2 UTSW 11 54126412 critical splice donor site probably null
R6632:P4ha2 UTSW 11 54117648 missense probably benign 0.07
R7023:P4ha2 UTSW 11 54131246 missense probably benign 0.01
R7068:P4ha2 UTSW 11 54110994 missense probably benign 0.03
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgaatcagcaagatgtgaacaag -3'
Posted On2014-04-13