Incidental Mutation 'R1556:Olfr59'
ID170287
Institutional Source Beutler Lab
Gene Symbol Olfr59
Ensembl Gene ENSMUSG00000070374
Gene Nameolfactory receptor 59
SynonymsMOR133-3P, IH3, GA_x6K02T2P1NL-4434429-4435400
MMRRC Submission 039595-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R1556 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location74283736-74291608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74288936 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 97 (C97S)
Ref Sequence ENSEMBL: ENSMUSP00000146212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143976] [ENSMUST00000205790] [ENSMUST00000206659] [ENSMUST00000214048]
Predicted Effect probably damaging
Transcript: ENSMUST00000119717
AA Change: C97S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112522
Gene: ENSMUSG00000070374
AA Change: C97S

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 2.2e-59 PFAM
Pfam:7tm_1 41 292 3.2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143976
AA Change: C97S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119877
Gene: ENSMUSG00000070374
AA Change: C97S

DomainStartEndE-ValueType
Pfam:7tm_1 41 237 7.5e-34 PFAM
Pfam:7tm_4 139 237 1.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205790
AA Change: C97S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000206659
AA Change: C97S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000214048
AA Change: C97S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,449,633 S302P probably damaging Het
Anapc1 T C 2: 128,624,899 T1626A probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Arid5a T A 1: 36,320,164 Y520* probably null Het
Aven G A 2: 112,630,885 M215I probably damaging Het
Cabyr A G 18: 12,744,780 D58G probably damaging Het
Ccdc146 A G 5: 21,330,553 Y168H probably damaging Het
Ccnd2 A T 6: 127,130,400 S269T probably benign Het
Cd68 T A 11: 69,665,850 T44S probably damaging Het
Clstn2 A T 9: 97,456,505 I867N probably benign Het
Cmss1 C T 16: 57,316,197 R104H probably benign Het
Col6a6 A G 9: 105,709,473 V1783A possibly damaging Het
Dach2 T C X: 113,298,517 S31P probably benign Het
Dpp8 T A 9: 65,051,479 W279R probably damaging Het
Fras1 A T 5: 96,743,062 I2817F possibly damaging Het
Gabrr3 G A 16: 59,461,400 D373N probably benign Het
Gdf7 T C 12: 8,301,698 N79S unknown Het
Gpam A G 19: 55,076,331 V647A possibly damaging Het
Gpatch1 T C 7: 35,295,351 T497A probably benign Het
Grin2a A T 16: 9,707,715 F337L probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
H2-Aa A T 17: 34,284,416 V69D possibly damaging Het
H2-M10.5 T C 17: 36,773,313 Y56H probably damaging Het
Kcnu1 G A 8: 25,861,191 probably null Het
Krt77 A G 15: 101,861,278 S386P probably damaging Het
L3mbtl2 T A 15: 81,682,002 M342K probably benign Het
Ldlrad1 A G 4: 107,217,813 T186A probably benign Het
Lins1 C A 7: 66,710,637 C168* probably null Het
Lrrtm3 G A 10: 64,088,149 T413M probably damaging Het
Macf1 T C 4: 123,455,020 D4038G probably damaging Het
Mark3 T G 12: 111,627,841 N308K probably damaging Het
Mdga2 T A 12: 66,550,593 Y709F possibly damaging Het
Mtus2 T A 5: 148,077,388 S330R probably benign Het
Olfr645 T A 7: 104,084,261 H273L probably benign Het
Olfr726 G A 14: 50,084,459 A74V possibly damaging Het
Olfr809 T C 10: 129,776,373 V168A probably benign Het
Ovgp1 A G 3: 105,986,752 probably benign Het
P4ha2 A G 11: 54,125,010 T408A probably damaging Het
Pcdh8 T G 14: 79,770,403 D240A probably damaging Het
Pcyt2 T C 11: 120,612,085 probably null Het
Pecr T A 1: 72,259,383 I293L probably benign Het
Pogk A G 1: 166,398,833 V583A possibly damaging Het
Prkg1 T C 19: 30,624,743 K371R probably benign Het
Psmd2 T A 16: 20,655,585 M297K possibly damaging Het
Rgs12 A G 5: 35,039,282 R769G possibly damaging Het
Sgtb T A 13: 104,139,776 N237K probably damaging Het
Sh3bgrl2 T C 9: 83,594,698 V91A probably damaging Het
Slc4a1ap G A 5: 31,534,210 probably null Het
Slc4a7 T C 14: 14,778,872 V940A probably benign Het
Tep1 T C 14: 50,853,042 T740A probably benign Het
Tnk2 G T 16: 32,670,919 probably null Het
Trpv2 A G 11: 62,592,233 Y450C probably damaging Het
Tvp23a A T 16: 10,446,998 D16E probably damaging Het
Twnk T C 19: 45,009,411 F460L possibly damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Urb2 T C 8: 124,030,617 L1021P probably damaging Het
Vps13c T C 9: 67,930,711 Y1848H probably damaging Het
Vwa8 T G 14: 79,086,681 N1141K probably benign Het
Yipf3 A G 17: 46,250,867 Y200C probably damaging Het
Zbtb38 A G 9: 96,686,991 V680A probably benign Het
Zcchc6 T C 13: 59,800,240 T354A probably benign Het
Znrf3 T C 11: 5,281,347 E722G probably benign Het
Zzef1 T A 11: 72,915,233 L2665H probably damaging Het
Other mutations in Olfr59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Olfr59 APN 11 74289126 missense probably damaging 1.00
IGL00337:Olfr59 APN 11 74289387 missense probably damaging 0.97
IGL01307:Olfr59 APN 11 74289428 missense possibly damaging 0.88
IGL01488:Olfr59 APN 11 74288688 missense probably damaging 1.00
IGL02583:Olfr59 APN 11 74289504 missense probably damaging 1.00
IGL02839:Olfr59 APN 11 74289370 nonsense probably null
IGL02996:Olfr59 APN 11 74289165 missense probably benign 0.08
R0013:Olfr59 UTSW 11 74289051 missense possibly damaging 0.88
R0077:Olfr59 UTSW 11 74288675 missense probably benign 0.00
R0078:Olfr59 UTSW 11 74289266 missense probably damaging 1.00
R0734:Olfr59 UTSW 11 74288946 missense probably damaging 1.00
R1033:Olfr59 UTSW 11 74288666 missense probably damaging 0.99
R1721:Olfr59 UTSW 11 74289300 missense probably damaging 1.00
R1737:Olfr59 UTSW 11 74288811 missense probably damaging 1.00
R1848:Olfr59 UTSW 11 74289213 missense probably damaging 0.99
R1881:Olfr59 UTSW 11 74288666 missense probably benign 0.08
R2057:Olfr59 UTSW 11 74288826 missense probably damaging 1.00
R2107:Olfr59 UTSW 11 74289390 missense probably damaging 1.00
R4399:Olfr59 UTSW 11 74288856 missense probably damaging 1.00
R4633:Olfr59 UTSW 11 74289294 missense probably benign 0.00
R5593:Olfr59 UTSW 11 74288792 missense possibly damaging 0.65
R5988:Olfr59 UTSW 11 74288853 missense probably benign
R6104:Olfr59 UTSW 11 74289366 missense probably damaging 1.00
Z1088:Olfr59 UTSW 11 74288835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGACCAGCACCTTTGAGTTCC -3'
(R):5'- CCAACAGGCTGTCACTAAGAGTGAG -3'

Sequencing Primer
(F):5'- cacatcctcttcctggtcttc -3'
(R):5'- TGTCACTAAGAGTGAGCAGCG -3'
Posted On2014-04-13