Incidental Mutation 'R1556:Gdf7'
ID170290
Institutional Source Beutler Lab
Gene Symbol Gdf7
Ensembl Gene ENSMUSG00000037660
Gene Namegrowth differentiation factor 7
SynonymsBMP12
MMRRC Submission 039595-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock #R1556 (G1)
Quality Score89
Status Not validated
Chromosome12
Chromosomal Location8297918-8301954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8301698 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 79 (N79S)
Ref Sequence ENSEMBL: ENSMUSP00000151234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037313] [ENSMUST00000220073]
Predicted Effect unknown
Transcript: ENSMUST00000037313
AA Change: N79S
SMART Domains Protein: ENSMUSP00000038301
Gene: ENSMUSG00000037660
AA Change: N79S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TGFb_propeptide 49 275 2.3e-15 PFAM
low complexity region 281 302 N/A INTRINSIC
low complexity region 308 357 N/A INTRINSIC
TGFB 360 461 1.14e-63 SMART
Predicted Effect unknown
Transcript: ENSMUST00000220073
AA Change: N79S
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein may play a role in the differentiation of tendon cells and spinal cord interneurons. Mice lacking a functional copy of this gene exhibit absence of some spinal dopaminergic neurons and brain defects, male sterility, and premature death. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele lack D1A neurons in the dorsal spinal cord; some develop severe hydrocephaly with dilated ventricles and late-onset brain defects. Mice homozygous for another null allele show premature death, hydrocephaly, aberrant seminal vesicle development and male sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,449,633 S302P probably damaging Het
Anapc1 T C 2: 128,624,899 T1626A probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Arid5a T A 1: 36,320,164 Y520* probably null Het
Aven G A 2: 112,630,885 M215I probably damaging Het
Cabyr A G 18: 12,744,780 D58G probably damaging Het
Ccdc146 A G 5: 21,330,553 Y168H probably damaging Het
Ccnd2 A T 6: 127,130,400 S269T probably benign Het
Cd68 T A 11: 69,665,850 T44S probably damaging Het
Clstn2 A T 9: 97,456,505 I867N probably benign Het
Cmss1 C T 16: 57,316,197 R104H probably benign Het
Col6a6 A G 9: 105,709,473 V1783A possibly damaging Het
Dach2 T C X: 113,298,517 S31P probably benign Het
Dpp8 T A 9: 65,051,479 W279R probably damaging Het
Fras1 A T 5: 96,743,062 I2817F possibly damaging Het
Gabrr3 G A 16: 59,461,400 D373N probably benign Het
Gpam A G 19: 55,076,331 V647A possibly damaging Het
Gpatch1 T C 7: 35,295,351 T497A probably benign Het
Grin2a A T 16: 9,707,715 F337L probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
H2-Aa A T 17: 34,284,416 V69D possibly damaging Het
H2-M10.5 T C 17: 36,773,313 Y56H probably damaging Het
Kcnu1 G A 8: 25,861,191 probably null Het
Krt77 A G 15: 101,861,278 S386P probably damaging Het
L3mbtl2 T A 15: 81,682,002 M342K probably benign Het
Ldlrad1 A G 4: 107,217,813 T186A probably benign Het
Lins1 C A 7: 66,710,637 C168* probably null Het
Lrrtm3 G A 10: 64,088,149 T413M probably damaging Het
Macf1 T C 4: 123,455,020 D4038G probably damaging Het
Mark3 T G 12: 111,627,841 N308K probably damaging Het
Mdga2 T A 12: 66,550,593 Y709F possibly damaging Het
Mtus2 T A 5: 148,077,388 S330R probably benign Het
Olfr59 T A 11: 74,288,936 C97S probably damaging Het
Olfr645 T A 7: 104,084,261 H273L probably benign Het
Olfr726 G A 14: 50,084,459 A74V possibly damaging Het
Olfr809 T C 10: 129,776,373 V168A probably benign Het
Ovgp1 A G 3: 105,986,752 probably benign Het
P4ha2 A G 11: 54,125,010 T408A probably damaging Het
Pcdh8 T G 14: 79,770,403 D240A probably damaging Het
Pcyt2 T C 11: 120,612,085 probably null Het
Pecr T A 1: 72,259,383 I293L probably benign Het
Pogk A G 1: 166,398,833 V583A possibly damaging Het
Prkg1 T C 19: 30,624,743 K371R probably benign Het
Psmd2 T A 16: 20,655,585 M297K possibly damaging Het
Rgs12 A G 5: 35,039,282 R769G possibly damaging Het
Sgtb T A 13: 104,139,776 N237K probably damaging Het
Sh3bgrl2 T C 9: 83,594,698 V91A probably damaging Het
Slc4a1ap G A 5: 31,534,210 probably null Het
Slc4a7 T C 14: 14,778,872 V940A probably benign Het
Tep1 T C 14: 50,853,042 T740A probably benign Het
Tnk2 G T 16: 32,670,919 probably null Het
Trpv2 A G 11: 62,592,233 Y450C probably damaging Het
Tvp23a A T 16: 10,446,998 D16E probably damaging Het
Twnk T C 19: 45,009,411 F460L possibly damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Urb2 T C 8: 124,030,617 L1021P probably damaging Het
Vps13c T C 9: 67,930,711 Y1848H probably damaging Het
Vwa8 T G 14: 79,086,681 N1141K probably benign Het
Yipf3 A G 17: 46,250,867 Y200C probably damaging Het
Zbtb38 A G 9: 96,686,991 V680A probably benign Het
Zcchc6 T C 13: 59,800,240 T354A probably benign Het
Znrf3 T C 11: 5,281,347 E722G probably benign Het
Zzef1 T A 11: 72,915,233 L2665H probably damaging Het
Other mutations in Gdf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02796:Gdf7 UTSW 12 8301666 missense unknown
R0781:Gdf7 UTSW 12 8301555 splice site probably benign
R1457:Gdf7 UTSW 12 8298073 missense probably damaging 0.97
R1643:Gdf7 UTSW 12 8297971 missense probably damaging 1.00
R2010:Gdf7 UTSW 12 8301729 missense unknown
R2439:Gdf7 UTSW 12 8298050 missense probably damaging 1.00
R2899:Gdf7 UTSW 12 8298470 missense unknown
R3894:Gdf7 UTSW 12 8298845 missense unknown
R4854:Gdf7 UTSW 12 8298014 missense probably damaging 0.99
R5207:Gdf7 UTSW 12 8298371 missense unknown
R6199:Gdf7 UTSW 12 8298832 missense unknown
R6583:Gdf7 UTSW 12 8301758 missense unknown
Predicted Primers PCR Primer
(F):5'- CATAGTTCAGGATCGAATCGGGCAG -3'
(R):5'- ACTATGTTCAAAAGGCGTCGGGG -3'

Sequencing Primer
(F):5'- CTCGTCTCCAGTCAAGAGTAG -3'
(R):5'- GTCTCTGGCTGCTGAGC -3'
Posted On2014-04-13