Incidental Mutation 'R1556:Psmd2'
ID170304
Institutional Source Beutler Lab
Gene Symbol Psmd2
Ensembl Gene ENSMUSG00000006998
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 2
SynonymsTEG-190, Tex190, 9430095H01Rik
MMRRC Submission 039595-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R1556 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location20651652-20663414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20655585 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 297 (M297K)
Ref Sequence ENSEMBL: ENSMUSP00000007212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007212] [ENSMUST00000172207] [ENSMUST00000232629]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007212
AA Change: M297K

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000007212
Gene: ENSMUSG00000006998
AA Change: M297K

DomainStartEndE-ValueType
Pfam:PC_rep 443 479 3.7e-9 PFAM
Pfam:PC_rep 480 514 1.3e-8 PFAM
low complexity region 571 581 N/A INTRINSIC
SCOP:d1gw5b_ 617 773 1e-8 SMART
PDB:4CR4|Z 653 906 3e-57 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169195
Predicted Effect probably benign
Transcript: ENSMUST00000172207
Predicted Effect probably benign
Transcript: ENSMUST00000231897
Predicted Effect probably benign
Transcript: ENSMUST00000232513
Predicted Effect probably benign
Transcript: ENSMUST00000232629
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. In addition to participation in proteasome function, this subunit may also participate in the TNF signalling pathway since it interacts with the tumor necrosis factor type 1 receptor. A pseudogene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,449,633 S302P probably damaging Het
Anapc1 T C 2: 128,624,899 T1626A probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Arid5a T A 1: 36,320,164 Y520* probably null Het
Aven G A 2: 112,630,885 M215I probably damaging Het
Cabyr A G 18: 12,744,780 D58G probably damaging Het
Ccdc146 A G 5: 21,330,553 Y168H probably damaging Het
Ccnd2 A T 6: 127,130,400 S269T probably benign Het
Cd68 T A 11: 69,665,850 T44S probably damaging Het
Clstn2 A T 9: 97,456,505 I867N probably benign Het
Cmss1 C T 16: 57,316,197 R104H probably benign Het
Col6a6 A G 9: 105,709,473 V1783A possibly damaging Het
Dach2 T C X: 113,298,517 S31P probably benign Het
Dpp8 T A 9: 65,051,479 W279R probably damaging Het
Fras1 A T 5: 96,743,062 I2817F possibly damaging Het
Gabrr3 G A 16: 59,461,400 D373N probably benign Het
Gdf7 T C 12: 8,301,698 N79S unknown Het
Gpam A G 19: 55,076,331 V647A possibly damaging Het
Gpatch1 T C 7: 35,295,351 T497A probably benign Het
Grin2a A T 16: 9,707,715 F337L probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
H2-Aa A T 17: 34,284,416 V69D possibly damaging Het
H2-M10.5 T C 17: 36,773,313 Y56H probably damaging Het
Kcnu1 G A 8: 25,861,191 probably null Het
Krt77 A G 15: 101,861,278 S386P probably damaging Het
L3mbtl2 T A 15: 81,682,002 M342K probably benign Het
Ldlrad1 A G 4: 107,217,813 T186A probably benign Het
Lins1 C A 7: 66,710,637 C168* probably null Het
Lrrtm3 G A 10: 64,088,149 T413M probably damaging Het
Macf1 T C 4: 123,455,020 D4038G probably damaging Het
Mark3 T G 12: 111,627,841 N308K probably damaging Het
Mdga2 T A 12: 66,550,593 Y709F possibly damaging Het
Mtus2 T A 5: 148,077,388 S330R probably benign Het
Olfr59 T A 11: 74,288,936 C97S probably damaging Het
Olfr645 T A 7: 104,084,261 H273L probably benign Het
Olfr726 G A 14: 50,084,459 A74V possibly damaging Het
Olfr809 T C 10: 129,776,373 V168A probably benign Het
Ovgp1 A G 3: 105,986,752 probably benign Het
P4ha2 A G 11: 54,125,010 T408A probably damaging Het
Pcdh8 T G 14: 79,770,403 D240A probably damaging Het
Pcyt2 T C 11: 120,612,085 probably null Het
Pecr T A 1: 72,259,383 I293L probably benign Het
Pogk A G 1: 166,398,833 V583A possibly damaging Het
Prkg1 T C 19: 30,624,743 K371R probably benign Het
Rgs12 A G 5: 35,039,282 R769G possibly damaging Het
Sgtb T A 13: 104,139,776 N237K probably damaging Het
Sh3bgrl2 T C 9: 83,594,698 V91A probably damaging Het
Slc4a1ap G A 5: 31,534,210 probably null Het
Slc4a7 T C 14: 14,778,872 V940A probably benign Het
Tep1 T C 14: 50,853,042 T740A probably benign Het
Tnk2 G T 16: 32,670,919 probably null Het
Trpv2 A G 11: 62,592,233 Y450C probably damaging Het
Tvp23a A T 16: 10,446,998 D16E probably damaging Het
Twnk T C 19: 45,009,411 F460L possibly damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Urb2 T C 8: 124,030,617 L1021P probably damaging Het
Vps13c T C 9: 67,930,711 Y1848H probably damaging Het
Vwa8 T G 14: 79,086,681 N1141K probably benign Het
Yipf3 A G 17: 46,250,867 Y200C probably damaging Het
Zbtb38 A G 9: 96,686,991 V680A probably benign Het
Zcchc6 T C 13: 59,800,240 T354A probably benign Het
Znrf3 T C 11: 5,281,347 E722G probably benign Het
Zzef1 T A 11: 72,915,233 L2665H probably damaging Het
Other mutations in Psmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Psmd2 APN 16 20659405 utr 5 prime probably null
IGL02348:Psmd2 APN 16 20654647 missense probably benign 0.07
IGL02352:Psmd2 APN 16 20656941 missense probably benign 0.13
IGL02359:Psmd2 APN 16 20656941 missense probably benign 0.13
R0012:Psmd2 UTSW 16 20661684 missense probably damaging 0.99
R0144:Psmd2 UTSW 16 20662225 splice site probably null
R0565:Psmd2 UTSW 16 20660426 missense probably null 0.63
R0739:Psmd2 UTSW 16 20655329 missense probably benign 0.01
R1075:Psmd2 UTSW 16 20659959 missense probably damaging 0.98
R1189:Psmd2 UTSW 16 20661894 missense probably benign 0.17
R1231:Psmd2 UTSW 16 20655585 missense possibly damaging 0.83
R1405:Psmd2 UTSW 16 20652284 missense possibly damaging 0.83
R1405:Psmd2 UTSW 16 20652284 missense possibly damaging 0.83
R1466:Psmd2 UTSW 16 20657965 unclassified probably benign
R1843:Psmd2 UTSW 16 20656582 missense probably benign 0.02
R2398:Psmd2 UTSW 16 20659472 missense possibly damaging 0.86
R2421:Psmd2 UTSW 16 20660106 intron probably null
R2520:Psmd2 UTSW 16 20663076 missense probably damaging 1.00
R3040:Psmd2 UTSW 16 20657567 missense probably benign 0.08
R3905:Psmd2 UTSW 16 20655642 missense probably benign 0.07
R3906:Psmd2 UTSW 16 20655642 missense probably benign 0.07
R3909:Psmd2 UTSW 16 20655642 missense probably benign 0.07
R4027:Psmd2 UTSW 16 20663205 missense probably damaging 0.98
R4029:Psmd2 UTSW 16 20663205 missense probably damaging 0.98
R4031:Psmd2 UTSW 16 20663205 missense probably damaging 0.98
R4357:Psmd2 UTSW 16 20656652 missense probably benign
R4410:Psmd2 UTSW 16 20655026 missense probably damaging 0.96
R4678:Psmd2 UTSW 16 20659969 missense probably damaging 1.00
R4737:Psmd2 UTSW 16 20659815 unclassified probably benign
R4771:Psmd2 UTSW 16 20662679 missense probably damaging 0.99
R5081:Psmd2 UTSW 16 20661655 missense probably benign 0.14
R5124:Psmd2 UTSW 16 20652698 missense possibly damaging 0.93
R5801:Psmd2 UTSW 16 20654922 missense probably damaging 0.96
R6381:Psmd2 UTSW 16 20655273 missense probably benign 0.03
R6732:Psmd2 UTSW 16 20662636 missense probably benign 0.02
R6870:Psmd2 UTSW 16 20661843 missense probably benign 0.33
R7030:Psmd2 UTSW 16 20662133 missense probably damaging 1.00
R7137:Psmd2 UTSW 16 20652627 missense probably benign 0.12
R7432:Psmd2 UTSW 16 20654925 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAAGCTCTGAGATTGGCACTGATG -3'
(R):5'- TTCGGCCAAAACCCTTCAGGAC -3'

Sequencing Primer
(F):5'- TGGCACTGATGCTCAATGAC -3'
(R):5'- CCTTCAGGACCAAGAGGAGAC -3'
Posted On2014-04-13