Incidental Mutation 'R1556:Tnk2'
ID170306
Institutional Source Beutler Lab
Gene Symbol Tnk2
Ensembl Gene ENSMUSG00000022791
Gene Nametyrosine kinase, non-receptor, 2
SynonymsACK1, Ack, P21cdc42Hs kinase, Pyk1, activated p21cdc42Hs kinase
MMRRC Submission 039595-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.423) question?
Stock #R1556 (G1)
Quality Score196
Status Not validated
Chromosome16
Chromosomal Location32643874-32683493 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 32670919 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115120] [ENSMUST00000115121] [ENSMUST00000115122] [ENSMUST00000115123] [ENSMUST00000115123] [ENSMUST00000115123] [ENSMUST00000115124] [ENSMUST00000115124] [ENSMUST00000115124] [ENSMUST00000115125] [ENSMUST00000115125] [ENSMUST00000115125] [ENSMUST00000115126] [ENSMUST00000115126] [ENSMUST00000115126] [ENSMUST00000131238] [ENSMUST00000145627] [ENSMUST00000152361]
Predicted Effect probably benign
Transcript: ENSMUST00000115120
SMART Domains Protein: ENSMUSP00000110773
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
Pfam:GTPase_binding 1 24 1.1e-8 PFAM
low complexity region 247 264 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 284 351 2.9e-30 PFAM
low complexity region 391 419 N/A INTRINSIC
Pfam:UBA 467 505 2.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115121
SMART Domains Protein: ENSMUSP00000110774
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
Pfam:GTPase_binding 1 24 4.5e-9 PFAM
low complexity region 27 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115122
Predicted Effect probably null
Transcript: ENSMUST00000115123
SMART Domains Protein: ENSMUSP00000110776
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 737 754 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 774 841 3e-30 PFAM
low complexity region 881 909 N/A INTRINSIC
Pfam:UBA 957 995 1.6e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115123
SMART Domains Protein: ENSMUSP00000110776
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 737 754 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 774 841 3e-30 PFAM
low complexity region 881 909 N/A INTRINSIC
Pfam:UBA 957 995 1.6e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115123
SMART Domains Protein: ENSMUSP00000110776
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 737 754 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 774 841 3e-30 PFAM
low complexity region 881 909 N/A INTRINSIC
Pfam:UBA 957 995 1.6e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115124
SMART Domains Protein: ENSMUSP00000110777
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 517 524 N/A INTRINSIC
low complexity region 752 769 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 789 855 5.3e-29 PFAM
low complexity region 896 924 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115124
SMART Domains Protein: ENSMUSP00000110777
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 517 524 N/A INTRINSIC
low complexity region 752 769 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 789 855 5.3e-29 PFAM
low complexity region 896 924 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115124
SMART Domains Protein: ENSMUSP00000110777
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 517 524 N/A INTRINSIC
low complexity region 752 769 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 789 855 5.3e-29 PFAM
low complexity region 896 924 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115125
SMART Domains Protein: ENSMUSP00000110778
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 737 754 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 774 841 7.2e-31 PFAM
low complexity region 881 909 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115125
SMART Domains Protein: ENSMUSP00000110778
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 737 754 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 774 841 7.2e-31 PFAM
low complexity region 881 909 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115125
SMART Domains Protein: ENSMUSP00000110778
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 737 754 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 774 841 7.2e-31 PFAM
low complexity region 881 909 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115126
SMART Domains Protein: ENSMUSP00000110779
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 517 524 N/A INTRINSIC
low complexity region 752 769 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 789 856 2.9e-30 PFAM
low complexity region 896 924 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115126
SMART Domains Protein: ENSMUSP00000110779
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 517 524 N/A INTRINSIC
low complexity region 752 769 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 789 856 2.9e-30 PFAM
low complexity region 896 924 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115126
SMART Domains Protein: ENSMUSP00000110779
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 517 524 N/A INTRINSIC
low complexity region 752 769 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 789 856 2.9e-30 PFAM
low complexity region 896 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131238
SMART Domains Protein: ENSMUSP00000129382
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
Pfam:GTPase_binding 1 24 1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141256
Predicted Effect probably benign
Transcript: ENSMUST00000145627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150383
Predicted Effect probably benign
Transcript: ENSMUST00000152361
SMART Domains Protein: ENSMUSP00000125905
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
SCOP:d1jo8a_ 8 38 2e-3 SMART
Pfam:GTPase_binding 39 106 2.8e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168506
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine kinase that binds Cdc42Hs in its GTP-bound form and inhibits both the intrinsic and GTPase-activating protein (GAP)-stimulated GTPase activity of Cdc42Hs. This binding is mediated by a unique sequence of 47 amino acids C-terminal to an SH3 domain. The protein may be involved in a regulatory mechanism that sustains the GTP-bound active form of Cdc42Hs and which is directly linked to a tyrosine phosphorylation signal transduction pathway. Several alternatively spliced transcript variants have been identified from this gene, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,449,633 S302P probably damaging Het
Anapc1 T C 2: 128,624,899 T1626A probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Arid5a T A 1: 36,320,164 Y520* probably null Het
Aven G A 2: 112,630,885 M215I probably damaging Het
Cabyr A G 18: 12,744,780 D58G probably damaging Het
Ccdc146 A G 5: 21,330,553 Y168H probably damaging Het
Ccnd2 A T 6: 127,130,400 S269T probably benign Het
Cd68 T A 11: 69,665,850 T44S probably damaging Het
Clstn2 A T 9: 97,456,505 I867N probably benign Het
Cmss1 C T 16: 57,316,197 R104H probably benign Het
Col6a6 A G 9: 105,709,473 V1783A possibly damaging Het
Dach2 T C X: 113,298,517 S31P probably benign Het
Dpp8 T A 9: 65,051,479 W279R probably damaging Het
Fras1 A T 5: 96,743,062 I2817F possibly damaging Het
Gabrr3 G A 16: 59,461,400 D373N probably benign Het
Gdf7 T C 12: 8,301,698 N79S unknown Het
Gpam A G 19: 55,076,331 V647A possibly damaging Het
Gpatch1 T C 7: 35,295,351 T497A probably benign Het
Grin2a A T 16: 9,707,715 F337L probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
H2-Aa A T 17: 34,284,416 V69D possibly damaging Het
H2-M10.5 T C 17: 36,773,313 Y56H probably damaging Het
Kcnu1 G A 8: 25,861,191 probably null Het
Krt77 A G 15: 101,861,278 S386P probably damaging Het
L3mbtl2 T A 15: 81,682,002 M342K probably benign Het
Ldlrad1 A G 4: 107,217,813 T186A probably benign Het
Lins1 C A 7: 66,710,637 C168* probably null Het
Lrrtm3 G A 10: 64,088,149 T413M probably damaging Het
Macf1 T C 4: 123,455,020 D4038G probably damaging Het
Mark3 T G 12: 111,627,841 N308K probably damaging Het
Mdga2 T A 12: 66,550,593 Y709F possibly damaging Het
Mtus2 T A 5: 148,077,388 S330R probably benign Het
Olfr59 T A 11: 74,288,936 C97S probably damaging Het
Olfr645 T A 7: 104,084,261 H273L probably benign Het
Olfr726 G A 14: 50,084,459 A74V possibly damaging Het
Olfr809 T C 10: 129,776,373 V168A probably benign Het
Ovgp1 A G 3: 105,986,752 probably benign Het
P4ha2 A G 11: 54,125,010 T408A probably damaging Het
Pcdh8 T G 14: 79,770,403 D240A probably damaging Het
Pcyt2 T C 11: 120,612,085 probably null Het
Pecr T A 1: 72,259,383 I293L probably benign Het
Pogk A G 1: 166,398,833 V583A possibly damaging Het
Prkg1 T C 19: 30,624,743 K371R probably benign Het
Psmd2 T A 16: 20,655,585 M297K possibly damaging Het
Rgs12 A G 5: 35,039,282 R769G possibly damaging Het
Sgtb T A 13: 104,139,776 N237K probably damaging Het
Sh3bgrl2 T C 9: 83,594,698 V91A probably damaging Het
Slc4a1ap G A 5: 31,534,210 probably null Het
Slc4a7 T C 14: 14,778,872 V940A probably benign Het
Tep1 T C 14: 50,853,042 T740A probably benign Het
Trpv2 A G 11: 62,592,233 Y450C probably damaging Het
Tvp23a A T 16: 10,446,998 D16E probably damaging Het
Twnk T C 19: 45,009,411 F460L possibly damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Urb2 T C 8: 124,030,617 L1021P probably damaging Het
Vps13c T C 9: 67,930,711 Y1848H probably damaging Het
Vwa8 T G 14: 79,086,681 N1141K probably benign Het
Yipf3 A G 17: 46,250,867 Y200C probably damaging Het
Zbtb38 A G 9: 96,686,991 V680A probably benign Het
Zcchc6 T C 13: 59,800,240 T354A probably benign Het
Znrf3 T C 11: 5,281,347 E722G probably benign Het
Zzef1 T A 11: 72,915,233 L2665H probably damaging Het
Other mutations in Tnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Tnk2 APN 16 32680680 missense probably damaging 0.99
IGL02212:Tnk2 APN 16 32680142 missense probably damaging 0.97
IGL02445:Tnk2 APN 16 32675590 missense probably benign 0.00
IGL02799:Tnk2 UTSW 16 32665881 splice site probably benign
R0310:Tnk2 UTSW 16 32680590 missense probably benign
R0989:Tnk2 UTSW 16 32680358 missense probably damaging 1.00
R1851:Tnk2 UTSW 16 32679462 missense probably damaging 1.00
R1854:Tnk2 UTSW 16 32680142 missense probably damaging 0.97
R1938:Tnk2 UTSW 16 32663742 start gained probably benign
R2137:Tnk2 UTSW 16 32670802 unclassified probably null
R2189:Tnk2 UTSW 16 32671421 missense probably damaging 1.00
R3772:Tnk2 UTSW 16 32679822 missense probably damaging 1.00
R4037:Tnk2 UTSW 16 32670796 missense probably damaging 1.00
R4413:Tnk2 UTSW 16 32669501 missense probably damaging 1.00
R4751:Tnk2 UTSW 16 32679857 missense probably damaging 1.00
R4878:Tnk2 UTSW 16 32679630 missense probably damaging 1.00
R4983:Tnk2 UTSW 16 32680465 missense probably damaging 1.00
R5063:Tnk2 UTSW 16 32670850 missense probably damaging 1.00
R5541:Tnk2 UTSW 16 32669523 missense probably benign 0.07
R5759:Tnk2 UTSW 16 32680664 missense probably benign
R5888:Tnk2 UTSW 16 32671367 missense probably damaging 1.00
R6142:Tnk2 UTSW 16 32670099 missense probably damaging 1.00
R6372:Tnk2 UTSW 16 32679785 missense probably damaging 1.00
R6717:Tnk2 UTSW 16 32670869 missense probably damaging 1.00
R6939:Tnk2 UTSW 16 32663878 missense probably damaging 1.00
R7157:Tnk2 UTSW 16 32681168 missense probably damaging 1.00
R7292:Tnk2 UTSW 16 32680800 missense probably benign
R7362:Tnk2 UTSW 16 32675520 critical splice acceptor site probably null
X0063:Tnk2 UTSW 16 32670850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGCCGTCCCTTTGACCTTTG -3'
(R):5'- GATCTTATGCAGGATCTGCCAGCC -3'

Sequencing Primer
(F):5'- AGTGACACCTGGATGTTTGG -3'
(R):5'- TGAAGATACCATCTGACATGGC -3'
Posted On2014-04-13