Incidental Mutation 'R1556:Yipf3'
ID170312
Institutional Source Beutler Lab
Gene Symbol Yipf3
Ensembl Gene ENSMUSG00000071074
Gene NameYip1 domain family, member 3
SynonymsD17Wsu94e
MMRRC Submission 039595-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.572) question?
Stock #R1556 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46248080-46252537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46250867 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 200 (Y200C)
Ref Sequence ENSEMBL: ENSMUSP00000092897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087026] [ENSMUST00000095262] [ENSMUST00000095263] [ENSMUST00000123311] [ENSMUST00000124655] [ENSMUST00000142706] [ENSMUST00000173232] [ENSMUST00000173349]
Predicted Effect probably benign
Transcript: ENSMUST00000087026
SMART Domains Protein: ENSMUSP00000084252
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 60 339 4.53e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095262
SMART Domains Protein: ENSMUSP00000092896
Gene: ENSMUSG00000071073

DomainStartEndE-ValueType
LRR 27 54 2.42e1 SMART
LRR 84 111 3.47e1 SMART
LRR 112 139 1.84e0 SMART
LRR 143 171 1.66e2 SMART
LRR 172 199 5.41e0 SMART
LRR 200 227 3.54e0 SMART
LRR 229 256 5.48e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095263
AA Change: Y200C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092897
Gene: ENSMUSG00000071074
AA Change: Y200C

DomainStartEndE-ValueType
low complexity region 59 75 N/A INTRINSIC
transmembrane domain 146 168 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
low complexity region 320 332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123311
AA Change: Y105C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115951
Gene: ENSMUSG00000071074
AA Change: Y105C

DomainStartEndE-ValueType
transmembrane domain 51 73 N/A INTRINSIC
transmembrane domain 88 110 N/A INTRINSIC
transmembrane domain 117 139 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 177 199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124126
Predicted Effect probably benign
Transcript: ENSMUST00000124655
SMART Domains Protein: ENSMUSP00000122026
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 1 253 2.14e-93 SMART
Predicted Effect unknown
Transcript: ENSMUST00000127378
AA Change: Y110C
SMART Domains Protein: ENSMUSP00000114937
Gene: ENSMUSG00000071074
AA Change: Y110C

DomainStartEndE-ValueType
Pfam:Yip1 30 178 4.6e-13 PFAM
low complexity region 189 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142706
SMART Domains Protein: ENSMUSP00000116998
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 60 255 9.13e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152583
Predicted Effect probably benign
Transcript: ENSMUST00000173232
SMART Domains Protein: ENSMUSP00000133597
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
Pfam:RNA_pol_L 61 100 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173349
SMART Domains Protein: ENSMUSP00000133861
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 42 170 2.3e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174392
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,449,633 S302P probably damaging Het
Anapc1 T C 2: 128,624,899 T1626A probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Arid5a T A 1: 36,320,164 Y520* probably null Het
Aven G A 2: 112,630,885 M215I probably damaging Het
Cabyr A G 18: 12,744,780 D58G probably damaging Het
Ccdc146 A G 5: 21,330,553 Y168H probably damaging Het
Ccnd2 A T 6: 127,130,400 S269T probably benign Het
Cd68 T A 11: 69,665,850 T44S probably damaging Het
Clstn2 A T 9: 97,456,505 I867N probably benign Het
Cmss1 C T 16: 57,316,197 R104H probably benign Het
Col6a6 A G 9: 105,709,473 V1783A possibly damaging Het
Dach2 T C X: 113,298,517 S31P probably benign Het
Dpp8 T A 9: 65,051,479 W279R probably damaging Het
Fras1 A T 5: 96,743,062 I2817F possibly damaging Het
Gabrr3 G A 16: 59,461,400 D373N probably benign Het
Gdf7 T C 12: 8,301,698 N79S unknown Het
Gpam A G 19: 55,076,331 V647A possibly damaging Het
Gpatch1 T C 7: 35,295,351 T497A probably benign Het
Grin2a A T 16: 9,707,715 F337L probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
H2-Aa A T 17: 34,284,416 V69D possibly damaging Het
H2-M10.5 T C 17: 36,773,313 Y56H probably damaging Het
Kcnu1 G A 8: 25,861,191 probably null Het
Krt77 A G 15: 101,861,278 S386P probably damaging Het
L3mbtl2 T A 15: 81,682,002 M342K probably benign Het
Ldlrad1 A G 4: 107,217,813 T186A probably benign Het
Lins1 C A 7: 66,710,637 C168* probably null Het
Lrrtm3 G A 10: 64,088,149 T413M probably damaging Het
Macf1 T C 4: 123,455,020 D4038G probably damaging Het
Mark3 T G 12: 111,627,841 N308K probably damaging Het
Mdga2 T A 12: 66,550,593 Y709F possibly damaging Het
Mtus2 T A 5: 148,077,388 S330R probably benign Het
Olfr59 T A 11: 74,288,936 C97S probably damaging Het
Olfr645 T A 7: 104,084,261 H273L probably benign Het
Olfr726 G A 14: 50,084,459 A74V possibly damaging Het
Olfr809 T C 10: 129,776,373 V168A probably benign Het
Ovgp1 A G 3: 105,986,752 probably benign Het
P4ha2 A G 11: 54,125,010 T408A probably damaging Het
Pcdh8 T G 14: 79,770,403 D240A probably damaging Het
Pcyt2 T C 11: 120,612,085 probably null Het
Pecr T A 1: 72,259,383 I293L probably benign Het
Pogk A G 1: 166,398,833 V583A possibly damaging Het
Prkg1 T C 19: 30,624,743 K371R probably benign Het
Psmd2 T A 16: 20,655,585 M297K possibly damaging Het
Rgs12 A G 5: 35,039,282 R769G possibly damaging Het
Sgtb T A 13: 104,139,776 N237K probably damaging Het
Sh3bgrl2 T C 9: 83,594,698 V91A probably damaging Het
Slc4a1ap G A 5: 31,534,210 probably null Het
Slc4a7 T C 14: 14,778,872 V940A probably benign Het
Tep1 T C 14: 50,853,042 T740A probably benign Het
Tnk2 G T 16: 32,670,919 probably null Het
Trpv2 A G 11: 62,592,233 Y450C probably damaging Het
Tvp23a A T 16: 10,446,998 D16E probably damaging Het
Twnk T C 19: 45,009,411 F460L possibly damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Urb2 T C 8: 124,030,617 L1021P probably damaging Het
Vps13c T C 9: 67,930,711 Y1848H probably damaging Het
Vwa8 T G 14: 79,086,681 N1141K probably benign Het
Zbtb38 A G 9: 96,686,991 V680A probably benign Het
Zcchc6 T C 13: 59,800,240 T354A probably benign Het
Znrf3 T C 11: 5,281,347 E722G probably benign Het
Zzef1 T A 11: 72,915,233 L2665H probably damaging Het
Other mutations in Yipf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Yipf3 APN 17 46250457 critical splice donor site probably null
IGL02469:Yipf3 APN 17 46250458 critical splice donor site probably null
IGL02836:Yipf3 APN 17 46251594 missense possibly damaging 0.63
R0077:Yipf3 UTSW 17 46251577 missense probably benign 0.42
R0334:Yipf3 UTSW 17 46248312 missense possibly damaging 0.93
R0398:Yipf3 UTSW 17 46251485 missense possibly damaging 0.86
R1163:Yipf3 UTSW 17 46251229 critical splice donor site probably null
R1398:Yipf3 UTSW 17 46251446 missense probably damaging 1.00
R1588:Yipf3 UTSW 17 46250861 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCATCCTCCTGCATGGAATGAAGAC -3'
(R):5'- GAGAGAGGACAGCACCATCACTTG -3'

Sequencing Primer
(F):5'- CTGCATGGAATGAAGACTTCTGAC -3'
(R):5'- ATCACTTGGGCTGCACAGAC -3'
Posted On2014-04-13