Incidental Mutation 'R1557:Kif7'
ID170344
Institutional Source Beutler Lab
Gene Symbol Kif7
Ensembl Gene ENSMUSG00000050382
Gene Namekinesin family member 7
Synonyms
MMRRC Submission 039596-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1557 (G1)
Quality Score209
Status Validated
Chromosome7
Chromosomal Location79698098-79715720 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 79714157 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000139224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000035939
SMART Domains Protein: ENSMUSP00000039696
Gene: ENSMUSG00000039133

DomainStartEndE-ValueType
low complexity region 101 123 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000059836
AA Change: M1T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382
AA Change: M1T

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000178048
AA Change: M1T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382
AA Change: M1T

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183846
AA Change: M1T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382
AA Change: M1T

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184137
AA Change: M1T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382
AA Change: M1T

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197011
Meta Mutation Damage Score 0.288 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cilia-associated protein belonging to the kinesin family. This protein plays a role in the sonic hedgehog (SHH) signaling pathway through the regulation of GLI transcription factors. It functions as a negative regulator of the SHH pathway by preventing inappropriate activation of GLI2 in the absence of ligand, and as a positive regulator by preventing the processing of GLI3 into its repressor form. Mutations in this gene have been associated with various ciliopathies. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, exencephaly, polydactyly, abnormal sternum, edema, abnormal ribs, and abnormal neurogenesis. Mice homozygous for an ENU-induced allele exhibit prenatal lethality, polydactyly, and abnormal neural tube development and neurogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A C 1: 53,181,866 D68E possibly damaging Het
Abca3 T C 17: 24,399,980 V870A possibly damaging Het
Aldh3a2 A T 11: 61,249,059 F416I probably damaging Het
Armc6 A T 8: 70,225,448 L77Q possibly damaging Het
Asb17 A G 3: 153,850,933 I226V probably benign Het
Aspm A G 1: 139,468,668 I862V probably benign Het
Atr T A 9: 95,871,449 D701E probably damaging Het
Baz1b C T 5: 135,218,243 L849F possibly damaging Het
Cbr1 T C 16: 93,608,789 V97A probably benign Het
Cep295 G A 9: 15,332,010 Q1669* probably null Het
Cfap54 T C 10: 92,984,227 T1242A possibly damaging Het
Chrm3 T A 13: 9,878,314 T229S possibly damaging Het
Cnga3 A G 1: 37,260,985 Y300C probably damaging Het
Col14a1 A C 15: 55,388,579 I544L unknown Het
Crocc T C 4: 141,025,465 E1208G probably damaging Het
Cyp2j8 A T 4: 96,470,476 probably benign Het
Dcbld2 T C 16: 58,465,350 I624T possibly damaging Het
Ddah1 A C 3: 145,891,472 I258L probably benign Het
Dnah6 G A 6: 73,049,131 Q3460* probably null Het
Dync2h1 T A 9: 7,140,911 D1372V probably damaging Het
Egln1 G A 8: 124,948,241 R272* probably null Het
Elf1 A G 14: 79,567,180 D95G possibly damaging Het
Fkbp5 A G 17: 28,402,755 F374L probably damaging Het
Fli1 T C 9: 32,461,244 probably benign Het
Gabbr2 T C 4: 46,846,436 T158A probably damaging Het
Gp2 A C 7: 119,450,079 Y412D probably damaging Het
Hmcn1 A G 1: 150,734,532 V1462A possibly damaging Het
Ide T C 19: 37,280,761 probably null Het
Kalrn T C 16: 34,314,278 K372R possibly damaging Het
Kcnj16 A G 11: 111,025,241 D243G possibly damaging Het
Klri2 A T 6: 129,732,211 L226Q probably damaging Het
Kremen1 T C 11: 5,215,373 probably null Het
Lama3 T C 18: 12,513,731 probably benign Het
Lmln C A 16: 33,088,211 R336S probably benign Het
Lrch4 T A 5: 137,637,556 D266E probably benign Het
Lrrc28 C T 7: 67,559,929 R174H probably damaging Het
Mib1 T A 18: 10,798,474 D778E probably damaging Het
Msra T C 14: 64,123,326 I125V possibly damaging Het
Olfr1180 A T 2: 88,412,211 V149E possibly damaging Het
Olfr1281 T A 2: 111,328,619 S67T probably damaging Het
Olfr670 A G 7: 104,960,540 F64S probably damaging Het
Olfr790 C A 10: 129,501,622 T246N probably damaging Het
Olfr930 A G 9: 38,930,659 M163V possibly damaging Het
Olfr95 A G 17: 37,211,353 F167L probably damaging Het
Pes1 T A 11: 3,976,824 Y369N probably damaging Het
Pgam2 T C 11: 5,801,773 D221G possibly damaging Het
Prl2c5 T C 13: 13,190,680 V137A possibly damaging Het
Rasal1 T A 5: 120,676,849 D721E possibly damaging Het
Sass6 G T 3: 116,618,732 E385D possibly damaging Het
Sema5a A G 15: 32,460,272 R60G probably benign Het
Sesn1 T C 10: 41,903,766 S399P probably damaging Het
Skiv2l G A 17: 34,848,422 L47F probably damaging Het
Slc10a2 C T 8: 5,091,755 V210M probably damaging Het
Slc8a3 C T 12: 81,315,557 G163S probably damaging Het
Sorbs2 T C 8: 45,759,197 probably benign Het
Speer4f1 T C 5: 17,479,492 W173R probably damaging Het
Spon2 C A 5: 33,216,764 G92W probably damaging Het
Sycp2 A T 2: 178,395,216 probably benign Het
Tex33 C A 15: 78,386,274 R98M probably damaging Het
Tfb1m A G 17: 3,554,966 V84A probably damaging Het
Tmem18 G T 12: 30,587,199 probably null Het
Tom1l1 A G 11: 90,656,384 L290S possibly damaging Het
Tube1 T G 10: 39,145,715 probably null Het
Ugt2b35 T A 5: 87,007,297 probably null Het
Unc93b1 T A 19: 3,942,403 Y269N probably benign Het
Usp16 T C 16: 87,462,142 probably null Het
Vmn1r38 A T 6: 66,776,386 S249T probably benign Het
Vmn1r42 T A 6: 89,844,751 M279L possibly damaging Het
Zdhhc23 T A 16: 43,971,466 T315S possibly damaging Het
Zfp472 T C 17: 32,975,926 F12L probably benign Het
Zfr2 T C 10: 81,247,391 S634P probably benign Het
Other mutations in Kif7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01545:Kif7 APN 7 79702278 missense probably damaging 0.99
IGL01551:Kif7 APN 7 79710566 critical splice acceptor site probably null
IGL01897:Kif7 APN 7 79701052 missense probably damaging 0.97
IGL02541:Kif7 APN 7 79710880 missense possibly damaging 0.46
IGL02873:Kif7 APN 7 79706759 missense probably damaging 1.00
IGL03409:Kif7 APN 7 79707553 missense probably benign 0.04
PIT4131001:Kif7 UTSW 7 79711069 missense probably damaging 1.00
R0053:Kif7 UTSW 7 79702179 missense probably benign
R0243:Kif7 UTSW 7 79699560 missense possibly damaging 0.66
R0280:Kif7 UTSW 7 79698823 missense probably benign
R0492:Kif7 UTSW 7 79713881 missense probably damaging 1.00
R0563:Kif7 UTSW 7 79702272 missense probably benign 0.00
R1637:Kif7 UTSW 7 79702837 missense probably damaging 1.00
R1889:Kif7 UTSW 7 79710463 missense probably damaging 1.00
R1934:Kif7 UTSW 7 79711538 missense probably benign 0.03
R1988:Kif7 UTSW 7 79699241 missense probably benign
R2259:Kif7 UTSW 7 79711589 missense probably damaging 1.00
R2418:Kif7 UTSW 7 79698693 missense probably benign 0.05
R2419:Kif7 UTSW 7 79698693 missense probably benign 0.05
R2511:Kif7 UTSW 7 79702264 missense probably damaging 1.00
R2975:Kif7 UTSW 7 79710260 missense probably damaging 1.00
R3711:Kif7 UTSW 7 79710892 missense probably benign 0.40
R3813:Kif7 UTSW 7 79713890 missense probably damaging 1.00
R4258:Kif7 UTSW 7 79710513 nonsense probably null
R4543:Kif7 UTSW 7 79707548 missense probably benign 0.03
R4648:Kif7 UTSW 7 79709191 missense probably damaging 1.00
R5650:Kif7 UTSW 7 79710979 missense probably damaging 1.00
R5941:Kif7 UTSW 7 79711132 intron probably benign
R6025:Kif7 UTSW 7 79704640 missense probably benign 0.34
R6056:Kif7 UTSW 7 79714094 missense possibly damaging 0.63
R6245:Kif7 UTSW 7 79702143 missense probably damaging 1.00
R6392:Kif7 UTSW 7 79702186 missense probably damaging 1.00
R6464:Kif7 UTSW 7 79714094 missense possibly damaging 0.63
X0063:Kif7 UTSW 7 79702278 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCACATGGAACCCAAAGTGTCGG -3'
(R):5'- TGGGCAGGTGTCAAGCAGTTTCAG -3'

Sequencing Primer
(F):5'- CAAAGTGTCGGTCCCGC -3'
(R):5'- ACCGGAGATATCAAGTGCTG -3'
Posted On2014-04-13