Incidental Mutation 'R1557:Cfap54'
ID170358
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Namecilia and flagella associated protein 54
SynonymsLOC380653, Gm872, 4930485B16Rik
MMRRC Submission 039596-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R1557 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location92775619-93081618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92984227 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1242 (T1242A)
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000170065] [ENSMUST00000212902]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168110
AA Change: T1242A

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: T1242A

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170065
Predicted Effect possibly damaging
Transcript: ENSMUST00000212902
AA Change: T1242A

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.004 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 96% (75/78)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A C 1: 53,181,866 D68E possibly damaging Het
Abca3 T C 17: 24,399,980 V870A possibly damaging Het
Aldh3a2 A T 11: 61,249,059 F416I probably damaging Het
Armc6 A T 8: 70,225,448 L77Q possibly damaging Het
Asb17 A G 3: 153,850,933 I226V probably benign Het
Aspm A G 1: 139,468,668 I862V probably benign Het
Atr T A 9: 95,871,449 D701E probably damaging Het
Baz1b C T 5: 135,218,243 L849F possibly damaging Het
Cbr1 T C 16: 93,608,789 V97A probably benign Het
Cep295 G A 9: 15,332,010 Q1669* probably null Het
Chrm3 T A 13: 9,878,314 T229S possibly damaging Het
Cnga3 A G 1: 37,260,985 Y300C probably damaging Het
Col14a1 A C 15: 55,388,579 I544L unknown Het
Crocc T C 4: 141,025,465 E1208G probably damaging Het
Cyp2j8 A T 4: 96,470,476 probably benign Het
Dcbld2 T C 16: 58,465,350 I624T possibly damaging Het
Ddah1 A C 3: 145,891,472 I258L probably benign Het
Dnah6 G A 6: 73,049,131 Q3460* probably null Het
Dync2h1 T A 9: 7,140,911 D1372V probably damaging Het
Egln1 G A 8: 124,948,241 R272* probably null Het
Elf1 A G 14: 79,567,180 D95G possibly damaging Het
Fkbp5 A G 17: 28,402,755 F374L probably damaging Het
Fli1 T C 9: 32,461,244 probably benign Het
Gabbr2 T C 4: 46,846,436 T158A probably damaging Het
Gp2 A C 7: 119,450,079 Y412D probably damaging Het
Hmcn1 A G 1: 150,734,532 V1462A possibly damaging Het
Ide T C 19: 37,280,761 probably null Het
Kalrn T C 16: 34,314,278 K372R possibly damaging Het
Kcnj16 A G 11: 111,025,241 D243G possibly damaging Het
Kif7 A G 7: 79,714,157 M1T probably null Het
Klri2 A T 6: 129,732,211 L226Q probably damaging Het
Kremen1 T C 11: 5,215,373 probably null Het
Lama3 T C 18: 12,513,731 probably benign Het
Lmln C A 16: 33,088,211 R336S probably benign Het
Lrch4 T A 5: 137,637,556 D266E probably benign Het
Lrrc28 C T 7: 67,559,929 R174H probably damaging Het
Mib1 T A 18: 10,798,474 D778E probably damaging Het
Msra T C 14: 64,123,326 I125V possibly damaging Het
Olfr1180 A T 2: 88,412,211 V149E possibly damaging Het
Olfr1281 T A 2: 111,328,619 S67T probably damaging Het
Olfr670 A G 7: 104,960,540 F64S probably damaging Het
Olfr790 C A 10: 129,501,622 T246N probably damaging Het
Olfr930 A G 9: 38,930,659 M163V possibly damaging Het
Olfr95 A G 17: 37,211,353 F167L probably damaging Het
Pes1 T A 11: 3,976,824 Y369N probably damaging Het
Pgam2 T C 11: 5,801,773 D221G possibly damaging Het
Prl2c5 T C 13: 13,190,680 V137A possibly damaging Het
Rasal1 T A 5: 120,676,849 D721E possibly damaging Het
Sass6 G T 3: 116,618,732 E385D possibly damaging Het
Sema5a A G 15: 32,460,272 R60G probably benign Het
Sesn1 T C 10: 41,903,766 S399P probably damaging Het
Skiv2l G A 17: 34,848,422 L47F probably damaging Het
Slc10a2 C T 8: 5,091,755 V210M probably damaging Het
Slc8a3 C T 12: 81,315,557 G163S probably damaging Het
Sorbs2 T C 8: 45,759,197 probably benign Het
Speer4f1 T C 5: 17,479,492 W173R probably damaging Het
Spon2 C A 5: 33,216,764 G92W probably damaging Het
Sycp2 A T 2: 178,395,216 probably benign Het
Tex33 C A 15: 78,386,274 R98M probably damaging Het
Tfb1m A G 17: 3,554,966 V84A probably damaging Het
Tmem18 G T 12: 30,587,199 probably null Het
Tom1l1 A G 11: 90,656,384 L290S possibly damaging Het
Tube1 T G 10: 39,145,715 probably null Het
Ugt2b35 T A 5: 87,007,297 probably null Het
Unc93b1 T A 19: 3,942,403 Y269N probably benign Het
Usp16 T C 16: 87,462,142 probably null Het
Vmn1r38 A T 6: 66,776,386 S249T probably benign Het
Vmn1r42 T A 6: 89,844,751 M279L possibly damaging Het
Zdhhc23 T A 16: 43,971,466 T315S possibly damaging Het
Zfp472 T C 17: 32,975,926 F12L probably benign Het
Zfr2 T C 10: 81,247,391 S634P probably benign Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 93081523 missense unknown
IGL02034:Cfap54 APN 10 93061485 missense probably damaging 0.99
IGL02082:Cfap54 APN 10 93081458 missense unknown
IGL02434:Cfap54 APN 10 93066754 missense probably benign 0.20
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0040:Cfap54 UTSW 10 92977039 missense probably benign 0.33
R0044:Cfap54 UTSW 10 93035433 missense probably null 0.28
R0086:Cfap54 UTSW 10 93028594 missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 93028652 missense probably damaging 1.00
R0194:Cfap54 UTSW 10 93034662 unclassified probably benign
R0234:Cfap54 UTSW 10 92899160 nonsense probably null
R0308:Cfap54 UTSW 10 92885364 missense unknown
R0332:Cfap54 UTSW 10 93035457 missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92776213 missense probably benign 0.00
R0433:Cfap54 UTSW 10 92979080 splice site probably benign
R0436:Cfap54 UTSW 10 93038975 missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92874943 critical splice donor site probably null
R0523:Cfap54 UTSW 10 92908883 utr 3 prime probably benign
R0551:Cfap54 UTSW 10 93025122 missense probably benign 0.35
R0595:Cfap54 UTSW 10 92884736 missense unknown
R0617:Cfap54 UTSW 10 92829650 splice site probably benign
R0632:Cfap54 UTSW 10 92885096 missense unknown
R0730:Cfap54 UTSW 10 93034737 missense probably benign 0.05
R0786:Cfap54 UTSW 10 92967535 missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92870669 missense unknown
R1004:Cfap54 UTSW 10 93066696 splice site probably benign
R1033:Cfap54 UTSW 10 92839449 missense probably benign 0.07
R1168:Cfap54 UTSW 10 92937920 missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92875994 missense unknown
R1429:Cfap54 UTSW 10 92821038 missense probably benign 0.01
R1443:Cfap54 UTSW 10 92932721 missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92969763 missense probably benign 0.01
R1687:Cfap54 UTSW 10 92932640 missense probably damaging 1.00
R1690:Cfap54 UTSW 10 93035442 missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 93011020 missense possibly damaging 0.86
R1756:Cfap54 UTSW 10 93048061 missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92904263 critical splice donor site probably null
R1835:Cfap54 UTSW 10 92962375 missense probably benign 0.35
R1889:Cfap54 UTSW 10 93034710 missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92884702 missense unknown
R1958:Cfap54 UTSW 10 92997342 missense probably benign 0.18
R2005:Cfap54 UTSW 10 92884768 missense unknown
R2018:Cfap54 UTSW 10 93016604 missense probably benign 0.00
R2045:Cfap54 UTSW 10 93038809 splice site probably null
R2059:Cfap54 UTSW 10 92942979 unclassified probably benign
R2100:Cfap54 UTSW 10 93001937 missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92886367 missense unknown
R2392:Cfap54 UTSW 10 93025011 critical splice donor site probably null
R2508:Cfap54 UTSW 10 92997374 missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92940155 missense probably damaging 1.00
R2857:Cfap54 UTSW 10 93045282 missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3108:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3157:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3158:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3159:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3161:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92885424 missense unknown
R3730:Cfap54 UTSW 10 93011473 nonsense probably null
R3770:Cfap54 UTSW 10 92878536 missense unknown
R3776:Cfap54 UTSW 10 93045100 missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92904344 utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92942873 unclassified probably benign
R3834:Cfap54 UTSW 10 92801123 splice site probably benign
R3891:Cfap54 UTSW 10 93038846 missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92829757 missense probably benign 0.03
R3973:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R4190:Cfap54 UTSW 10 92885023 missense unknown
R4389:Cfap54 UTSW 10 92967500 missense probably benign 0.37
R4542:Cfap54 UTSW 10 93025129 missense probably benign 0.12
R4564:Cfap54 UTSW 10 92839540 unclassified probably benign
R4576:Cfap54 UTSW 10 93043228 critical splice donor site probably null
R4620:Cfap54 UTSW 10 92969757 missense probably benign 0.01
R4714:Cfap54 UTSW 10 92815918 missense probably benign 0.01
R4762:Cfap54 UTSW 10 93061453 splice site probably null
R4776:Cfap54 UTSW 10 92972694 missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92836477 nonsense probably null
R4827:Cfap54 UTSW 10 92902075 utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92967528 missense probably benign 0.01
R4965:Cfap54 UTSW 10 93066799 missense probably benign 0.23
R5001:Cfap54 UTSW 10 92964534 missense probably benign 0.01
R5060:Cfap54 UTSW 10 93039151 missense probably damaging 1.00
R5067:Cfap54 UTSW 10 93066766 missense probably benign 0.17
R5069:Cfap54 UTSW 10 92937774 missense probably benign
R5094:Cfap54 UTSW 10 92898999 utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92937891 missense probably benign 0.03
R5127:Cfap54 UTSW 10 92886387 splice site probably null
R5143:Cfap54 UTSW 10 93029158 missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92937838 missense probably benign 0.00
R5158:Cfap54 UTSW 10 93065197 missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92935091 nonsense probably null
R5256:Cfap54 UTSW 10 93045023 splice site probably null
R5266:Cfap54 UTSW 10 92815902 missense probably benign 0.16
R5304:Cfap54 UTSW 10 92821106 missense probably damaging 0.97
R5369:Cfap54 UTSW 10 93061257 intron probably benign
R5406:Cfap54 UTSW 10 93001858 missense probably benign 0.33
R5471:Cfap54 UTSW 10 93028660 missense probably damaging 1.00
R5485:Cfap54 UTSW 10 93029117 missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92972608 missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92972611 nonsense probably null
R5614:Cfap54 UTSW 10 93045049 missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92904263 critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92979017 nonsense probably null
R5797:Cfap54 UTSW 10 92967576 missense probably benign 0.11
R5859:Cfap54 UTSW 10 93016524 nonsense probably null
R5878:Cfap54 UTSW 10 92964561 missense probably benign 0.01
R5910:Cfap54 UTSW 10 93065181 missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R5994:Cfap54 UTSW 10 93039081 missense probably damaging 0.99
R6080:Cfap54 UTSW 10 93045335 missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 93038909 missense probably damaging 1.00
R6296:Cfap54 UTSW 10 93066846 missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92967492 missense probably benign 0.04
R6545:Cfap54 UTSW 10 92836457 missense probably benign 0.31
R6570:Cfap54 UTSW 10 92815958 missense unknown
R6597:Cfap54 UTSW 10 92999040 missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92868734 missense unknown
R6703:Cfap54 UTSW 10 92868734 missense unknown
R6720:Cfap54 UTSW 10 92821119 missense probably benign 0.07
R6841:Cfap54 UTSW 10 92875015 missense unknown
R6910:Cfap54 UTSW 10 92836512 missense probably benign 0.29
R6953:Cfap54 UTSW 10 92994678 missense probably benign 0.19
X0022:Cfap54 UTSW 10 92878603 missense unknown
X0022:Cfap54 UTSW 10 92932614 missense probably damaging 1.00
X0027:Cfap54 UTSW 10 92878538 missense unknown
X0027:Cfap54 UTSW 10 93001888 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CGCTTGAAGCGTGAACTATTCAACC -3'
(R):5'- GCTTCCGGCTTTCTTAACAATGGTG -3'

Sequencing Primer
(F):5'- aaagggggagtgggtgg -3'
(R):5'- ATTGTTAGGCTCACAAGACTTAGGG -3'
Posted On2014-04-13