Incidental Mutation 'R1558:Fastk'
ID170409
Institutional Source Beutler Lab
Gene Symbol Fastk
Ensembl Gene ENSMUSG00000028959
Gene NameFas-activated serine/threonine kinase
Synonyms
MMRRC Submission 039597-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1558 (G1)
Quality Score170
Status Not validated
Chromosome5
Chromosomal Location24438440-24445287 bp(-) (GRCm38)
Type of Mutationunclassified (3100 bp from exon)
DNA Base Change (assembly) A to T at 24444047 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030799] [ENSMUST00000030800] [ENSMUST00000080067] [ENSMUST00000115033] [ENSMUST00000115036] [ENSMUST00000115041] [ENSMUST00000115043] [ENSMUST00000115047] [ENSMUST00000115049] [ENSMUST00000123167] [ENSMUST00000127194] [ENSMUST00000144389]
Predicted Effect probably benign
Transcript: ENSMUST00000030799
SMART Domains Protein: ENSMUSP00000030799
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000030800
AA Change: L114H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030800
Gene: ENSMUSG00000028959
AA Change: L114H

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
Pfam:FAST_1 274 340 7.4e-18 PFAM
Pfam:FAST_2 351 440 5e-20 PFAM
RAP 475 532 3.04e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000080067
SMART Domains Protein: ENSMUSP00000078972
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 93 110 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
low complexity region 138 151 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 296 313 N/A INTRINSIC
Pfam:Band_3_cyto 348 616 4.7e-111 PFAM
Pfam:HCO3_cotransp 671 1165 1.7e-217 PFAM
transmembrane domain 1183 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115033
SMART Domains Protein: ENSMUSP00000110685
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115036
SMART Domains Protein: ENSMUSP00000110688
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
transmembrane domain 26 45 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
UBQ 117 186 4.58e-4 SMART
low complexity region 190 206 N/A INTRINSIC
transmembrane domain 207 229 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115041
SMART Domains Protein: ENSMUSP00000110693
Gene: ENSMUSG00000028959

DomainStartEndE-ValueType
low complexity region 43 57 N/A INTRINSIC
low complexity region 101 112 N/A INTRINSIC
Pfam:FAST_1 136 204 5.4e-24 PFAM
Pfam:FAST_2 212 303 4.7e-26 PFAM
RAP 338 395 3.04e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115043
AA Change: L114H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110695
Gene: ENSMUSG00000028959
AA Change: L114H

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
Pfam:FAST_1 273 341 7.6e-24 PFAM
Pfam:FAST_2 349 440 6.9e-26 PFAM
Pfam:RAP 475 513 1.4e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115047
SMART Domains Protein: ENSMUSP00000110699
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 79 96 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
low complexity region 124 137 N/A INTRINSIC
low complexity region 155 164 N/A INTRINSIC
low complexity region 186 202 N/A INTRINSIC
low complexity region 282 299 N/A INTRINSIC
Pfam:Band_3_cyto 334 602 7.2e-108 PFAM
Pfam:HCO3_cotransp 656 1151 1e-244 PFAM
transmembrane domain 1169 1186 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115049
SMART Domains Protein: ENSMUSP00000110701
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 84 101 N/A INTRINSIC
low complexity region 103 126 N/A INTRINSIC
low complexity region 129 142 N/A INTRINSIC
low complexity region 160 169 N/A INTRINSIC
low complexity region 191 207 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
Pfam:Band_3_cyto 339 607 7.3e-108 PFAM
Pfam:HCO3_cotransp 661 1156 1e-244 PFAM
transmembrane domain 1174 1191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123144
Predicted Effect probably benign
Transcript: ENSMUST00000123167
SMART Domains Protein: ENSMUSP00000122487
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
Blast:UBQ 102 122 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127194
SMART Domains Protein: ENSMUSP00000123173
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
low complexity region 175 204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140722
Predicted Effect silent
Transcript: ENSMUST00000144389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198786
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase was shown to be activated rapidly during Fas-mediated apoptosis in Jurkat cells. In response to Fas receptor ligation, it phosphorylates TIA1, an apoptosis-promoting nuclear RNA-binding protein. The encoded protein is a strong inducer of lymphocyte apoptosis. Two transcript variants encoding different isoforms have been found for this gene. Other variants exist, but their full-length natures have not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele lack neutophil infiltration in a model of house dust mite induced allergic pulmonary inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,705 I708F probably benign Het
4933406M09Rik G A 1: 134,390,774 G428D probably damaging Het
Abca1 T A 4: 53,092,887 Q299L probably null Het
Adamts9 T G 6: 92,908,711 K399N possibly damaging Het
Alox12b T C 11: 69,165,885 F369S probably damaging Het
Alpk2 A G 18: 65,350,230 Y236H probably benign Het
Ankrd36 T C 11: 5,635,329 L380P probably damaging Het
Atp2a1 C T 7: 126,452,672 A468T possibly damaging Het
Caprin1 A T 2: 103,775,987 F303I possibly damaging Het
Casp7 A T 19: 56,433,252 R41* probably null Het
Ccdc66 T A 14: 27,486,506 H753L probably benign Het
Ccnc T C 4: 21,742,671 M166T probably benign Het
Cdkl3 T A 11: 52,032,510 M538K possibly damaging Het
Cercam G A 2: 29,876,239 A345T probably benign Het
Chmp3 T A 6: 71,560,970 C60* probably null Het
Ddx1 C T 12: 13,239,541 G125S probably damaging Het
Defb7 A G 8: 19,497,551 D24G probably benign Het
Dgcr8 A T 16: 18,259,588 Y653N probably damaging Het
Dsc2 T C 18: 20,050,151 D70G probably damaging Het
Erich3 T G 3: 154,714,068 N266K probably damaging Het
Fat4 A G 3: 38,888,986 N676S probably damaging Het
Fermt1 A T 2: 132,934,819 probably null Het
Fmn1 A G 2: 113,693,118 T1149A possibly damaging Het
Foxo3 A G 10: 42,197,072 V483A probably damaging Het
Fpgs T C 2: 32,685,840 T364A possibly damaging Het
Gm12185 A G 11: 48,915,435 S310P probably damaging Het
Gm15056 A T 8: 20,901,933 probably benign Het
Hcn1 T C 13: 117,975,576 V692A unknown Het
Izumo3 A C 4: 92,146,903 C26G probably damaging Het
Kcnf1 T C 12: 17,175,473 Y249C probably damaging Het
Kcnj6 T C 16: 94,762,499 E380G possibly damaging Het
Kdm3b A G 18: 34,809,096 T747A probably damaging Het
Lrba G A 3: 86,351,315 G1370R probably damaging Het
Mei1 G A 15: 82,107,133 R504Q probably damaging Het
Mipol1 T C 12: 57,332,341 I195T probably damaging Het
Mum1 G T 10: 80,232,944 R307S probably benign Het
Ncor2 G A 5: 125,033,546 T1350I probably damaging Het
Npy A G 6: 49,823,725 E43G probably damaging Het
Olfr1152 T A 2: 87,868,115 N41K probably damaging Het
Olfr1507 T A 14: 52,490,146 I273F probably benign Het
Olfr924 T A 9: 38,848,904 N263K probably benign Het
Pcdhb3 T C 18: 37,301,581 L200P probably damaging Het
Pcnt G A 10: 76,422,922 H570Y possibly damaging Het
Pkd1l2 A C 8: 117,082,252 D66E possibly damaging Het
Plekhg4 A G 8: 105,381,835 D1170G possibly damaging Het
Poln T A 5: 34,032,799 H672L probably benign Het
Pqlc2 A T 4: 139,300,080 probably benign Het
Ptprq T C 10: 107,644,043 Y1122C probably damaging Het
Ptrhd1 A G 12: 4,236,505 Y132C probably damaging Het
Riok1 G T 13: 38,050,855 R300L probably damaging Het
Sbf2 G T 7: 110,428,346 T481K probably damaging Het
Sidt2 A T 9: 45,951,800 M11K probably damaging Het
Syne1 G A 10: 5,349,280 R992* probably null Het
Tmem2 T A 19: 21,797,982 Y196* probably null Het
Tmem8b C A 4: 43,681,134 R384S possibly damaging Het
Trim28 T C 7: 13,027,834 Y243H probably damaging Het
Trpm6 T C 19: 18,786,828 M266T probably benign Het
Tsg101 A T 7: 46,889,689 S368T probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttc6 G A 12: 57,686,346 V1092I probably benign Het
Vps13b C T 15: 35,534,319 T927I probably damaging Het
Zfr C T 15: 12,140,644 T259I unknown Het
Other mutations in Fastk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02149:Fastk APN 5 24444053 missense probably damaging 0.99
IGL02313:Fastk APN 5 24443092 missense probably damaging 1.00
IGL02374:Fastk APN 5 24444249 missense possibly damaging 0.48
R0244:Fastk UTSW 5 24442178 splice site probably benign
R0733:Fastk UTSW 5 24443923 missense probably null 0.61
R1181:Fastk UTSW 5 24441731 critical splice donor site probably null
R1735:Fastk UTSW 5 24441803 missense probably damaging 1.00
R1815:Fastk UTSW 5 24441531 missense probably damaging 1.00
R2134:Fastk UTSW 5 24445141 missense probably damaging 0.99
R3934:Fastk UTSW 5 24442259 nonsense probably null
R4608:Fastk UTSW 5 24443119 missense probably damaging 1.00
R6671:Fastk UTSW 5 24441609 missense probably damaging 0.99
X0022:Fastk UTSW 5 24444278 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CCAAGTAACACTGCAAGGTGGAGAC -3'
(R):5'- ACCCAGCTCCATGCTTCGAATC -3'

Sequencing Primer
(F):5'- CACACATGGATGGTGTGAAC -3'
(R):5'- AGACTTCCCCTGCTCGG -3'
Posted On2014-04-13